Abstract
Free full text
Raising gestational choline intake alters gene expression in DMBA-evoked mammary tumors and prolongs survival
Abstract
Choline is an essential nutrient that serves as a donor of metabolic methyl groups used during gestation to establish the epigenetic DNA methylation patterns that modulate tissue-specific gene expression. Because the mammary gland begins its development prenatally, we hypothesized that choline availability in utero may affect the gland’s susceptibility to cancer. During gestational days 11–17, pregnant rats were fed a control, choline-supplemented, or choline-deficient diet (8, 36, and 0 mmol/kg of choline, respectively). On postnatal day 65, the female offspring received 25 mg/kg of a carcinogen 7,12-dimethylbenz[α]anthracene. Approximately 70% of the rats developed mammary adenocarcinomas; prenatal diet did not affect tumor latency, incidence, size, and multiplicity. Tumor growth rate was inversely related to choline content in the prenatal diet, resulting in 50% longer survival until euthanasia, determined by tumor size, of the prenatally choline-supplemented rats compared with the prenatally choline-deficient rats. This was accompanied by distinct expression patterns of ~70 genes in tumors derived from the three dietary groups. Tumors from the prenatally choline-supplemented rats overexpressed genes that confer favorable prognosis in human cancers (Klf6, Klf9, Nid2, Ntn4, Per1, and Txnip) and underexpressed those associated with aggressive disease (Bcar3, Cldn12, Csf1, Jag1, Lgals3, Lypd3, Nme1, Ptges2, Ptgs1, and Smarcb1). DNA methylation within the tumor suppressor gene, stratifin (Sfn, 14-3-3σ), was proportional to the prenatal choline supply and correlated inversely with the expression of its mRNA and protein in tumors, suggesting that an epigenetic mechanism may underlie the altered molecular phenotype and tumor growth. Our results suggest a role for adequate maternal choline nutrition during pregnancy in prevention/alleviation of breast cancer in daughters.—Kovacheva, V. P., Davison, J. M., Mellott, T. J., Rogers, A. E., Yang, S., O’Brien, M. J., Blusztajn, J. K. Raising gestational choline intake alters gene expression in DMBA-evoked mammary tumors and prolongs survival. (2009)
Development of the mammary gland begins prenatally. During the fourth week of human gestation, its earliest differentiating structures can be observed, and their size and complexity increase until birth (1). Therefore, the prenatal period may render the gland vulnerable to the conditions in its milieu that may influence the risk of breast cancer in adulthood (2). Indeed, there is evidence that high birth weight (birth size) is associated with increased breast cancer risk, suggesting that generalized nutritional factors may play a role in the predisposition to this disease (3), and correlative data point to in utero exposure to high estrogen levels and possibly high insulin-like growth factor I levels in increasing the risk (4). Studies in animal models have provided direct evidence that specific nutrients in the maternal diet during pregnancy strongly influence mammary carcinogenesis in the adult offspring. In a pioneering study, Hilakivi-Clarke et al. (5) used a well-established mammary cancer model—i.e., young female rats exposed to the carcinogen 7,12-dimethylbenz[α]anthracene (DMBA), which causes tumors histologically similar to human breast cancers (6)—and showed that consumption during pregnancy of a diet enriched in corn oil, which is high in n-6 polyunsaturated fatty acids, increases the susceptibility of adult offspring to DMBA-induced mammary tumors.
Recent years have witnessed a renewed interest in the study of the health significance of dietary choline—a metabolic methyl group donor, a precursor of the neurotransmitter acetylcholine and of membrane phospholipids like phosphatidylcholine—as a result of its classification by the National Academy of Sciences as an essential nutrient for humans (7). Since that time, a comprehensive database on the content of choline and of its metabolite, betaine, in common foods has been compiled (http://www.nal.usda.gov/fnic/foodcomp/Data/Choline/Choline.html) and has provided epidemiologists with a resource to detect possible relationships between the dietary intake of these compounds and human disease. Recent population studies used this tool and found that women in the highest quintile of choline consumption as adults had reduced risk of breast cancer (8) and high intake of choline and of its metabolite, betaine, during pregnancy was associated with lowered risk of neural tube defects in offspring (9). These studies are the first to provide evidence for a preventive action of choline in human carcinogenesis and for significance of choline nutrition during pregnancy for normal human fetal development. In rodents, gestational consumption of choline is important for the development and function of the brain (10,11,12,13). In a frequently used experimental model that employs offspring of pregnant rats or mice consuming diets of varying choline content during the 7-day period of the second half of gestation [embryonic days (E) 11–17], prenatal choline deficiency impairs memory (14, 15), while prenatal choline supplementation improves it and, remarkably, prevents age-related memory decline (10, 11, 13). These behavioral changes are accompanied by electrophysiological, neuroanatomical, and neurochemical alterations that persist until old age (10, 11, 13) and, notably, by altered postnatal patterns of brain gene expression (16). Choline, following conversion to betaine and S-adenosylmethionine, acts as a donor of methyl groups that can be utilized for DNA and histone methylation, the salient processes in epigenetic modulation of gene expression (17) that are frequently dysregulated in, and responsible for, the progression of multiple types of cancers (18). Indeed, the molecular correlates of the long-term effects of prenatal choline intake include altered S-adenosylmethionine production (19) and modified global- and gene-specific (e.g., Igf2) DNA methylation in brain and liver (19, 20).
The mammary gland formation in rodents begins on E10–11, and a small ductal tree is seen by birth (21), i.e., the time when maternal choline nutrition influences the development of other organs like brain and liver, and thus we hypothesized that varying the supply of choline to the mammary tissue during the E11–17 period may affect its vulnerability to carcinogenesis. We found that high choline intake during this period slows the growth of DMBA-evoked mammary tumors and alters their gene expression, and DNA methylation patterns.
MATERIALS AND METHODS
Animals, diets, carcinogen treatment, and tumor sample collection
During gestational days E11–17, timed pregnant Sprague-Dawley rats (n=15/group) were fed an AIN76A diet (Dyets Inc., Bethlehem, PA, USA) that contained no choline (deficient) or 8 (control) or 36 mmol/kg of choline chloride (supplemented). Subsequently, all dams and offspring consumed the control diet. DMBA (25 mg/kg; n=48/dietary group) or vehicle (sesame oil; n=6/group) was administered by gavage on postnatal day (P) 65 to female offspring (22). The animals were monitored for tumor incidence, multiplicity, and size for 162 days (P227) by an observer unaware of the dietary treatment. For humane reasons, animals were euthanized before P227 if they developed a tumor of 3 cm in diameter. All animal procedures were performed in accordance with protocols approved by the Boston University School of Medicine Institutional Animal Care and Use Committee. Tumors, collected from these rats and from all remaining animals on P227, were rapidly removed and divided into 3 parts: 1) for RNA and DNA analyses, homogenized in guanidine isothiocyanate solution and frozen at −70°C; 2) for histological studies, fixed and postfixed in PLP (4% paraformaldehyde, 75 mM lysine, and 10 mM sodium periodate; pH 7.4) and then cryoprotected; and 3) for protein analyses, frozen at −70°C. The analyses were performed on the largest tumor of an experimental rat, and only non-necrotic areas of each tumor were utilized.
Microarray studies
Tumor RNA (n=4/dietary group; each subject born to a different mother) was analyzed with the Illumina Rat Ref-12 BeadChips (Illumina, Inc., San Diego, CA, USA). Following average normalization with Illumina BeadStudio v. 3.0, the data were analyzed by significance analysis of microarrays software (23), employing the “multiclass” option with the parameter delta of 0.33 so that false discovery rate (FDR) was below 25%. This analysis generated a set of 72 genes. Following z-score transformation, Eisen cluster analysis (24) was performed using Cluster 3.0 software (Human Genome Center, University of Tokyo, Tokyo, Japan) and visualized by Java TreeView Version 1.1.1.
Reverse transcriptase-polymerase chain reaction (RT-PCR)
RNAs analyzed by microarray were used for RT-PCR using Superscript One-Step RT-PCR with Platinum Taq (Invitrogen, Life Technologies, Carlsbad, CA, USA). cDNA synthesis was performed with 10 ng RNA, oligo dT primer, and reverse transcriptase at 48°C for 45 min. The following primer sets were used: Bcar3, forward CCAGATGCGATTGTTGTGG, reverse TGATAAGCATTCCCGGAGG; Jag1, forward, AACTGGTACCGGTGCGAA, reverse, TGATGCAAGATCTCCCTGAAA; Sfn, forward GATGAGGACATGACACTGACCC, reverse TGGAAGACGGAAAAGTTCAGG; and β-actin, forward, CACAGCTGAGAGGGAAATC, reverse TCAGCAATGCCTGGGTAC. PCR conditions were 2 min at 94°C followed by 34 cycles of: 1 min at 94°C, 1 min at 58°C and 2 min at 70°C and terminated by 72°C for 7 min. These conditions were in the linear range of the assays. The products were resolved on 10% Tris-buffered EDTA polyacrylamide gels and stained with ethidium bromide; band intensities were quantified with a Kodak Image Station (Eastman Kodak, Rochester, NY, USA). The expression level was calculated as a percentage of the control after normalizing to β-actin.
Methylation-specific PCR of Stratifin gene
DNA (1 μg) was treated with sodium bisulfite using the EZ DNA methylation kit (Zymo Research, Orange, CA, USA). Methylation-specific PCR (MSP) of the CpG island within Sfn exon I was performed with primers designed by MethPrimer (25). The forward primers spanned 22 bp in exon I, starting at 41 bp after translation initiation, and included the first 4 CpGs within the exon; the reverse primers contained the 11th CpG, located 176 bp after translation initiation. The primer sequences were methylated forward, GGTCGAATAGGTCGAACGTTAC; methylated reverse, ATACTAAACAAAACTCTCCAAACCG; unmethylated forward, TGGTTGAATAGGTTGAATGTTATGA; unmethylated reverse, ACTAAACAAAACTCTCCAAACCACT. The reaction conditions (60 ng of template) were 1 cycle of 94°C for 2 min, 1 min at annealing temperature [methylated, 57.6°C, unmethylated, 54.1°C], and 2 min at 70°C; then 37 cycles of 94°C for 30 s, annealing 40 s, and 72°C for 1 min, and finally 70°C for 10 min. These conditions were in the linear range of the assay. The PCR products were processed as above. The methylation level was calculated using the ratio of the intensity of the methylated product divided by the unmethylated product.
Immunoblotting
Immunoblotting was performed as described previously (16) using 30 μg of tumor protein. The primary antibodies were polyclonal anti-Jagged-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-Stratifin/14-3-3σ (Millipore, Billerica, MA, USA), both diluted 1:500, polyclonal anti-mouse Bcar3 (a gift from Adam Lerner, Boston University School of Medicine, Boston, MA, USA) diluted 1:1000, and monoclonal anti-β-actin (Sigma, St. Louis, MO, USA) diluted 1:2000. Horseradish peroxidase-conjugated secondary antibodies anti-rabbit or anti-mouse (Bio-Rad Laboratories, Hercules, CA, USA) were used, followed by chemiluminescent detection with the Kodak Image Station.
Immunohistochemical analysis
The sections were incubated with 1:100 diluted rabbit polyclonal anti-Jag1 antibody (Santa Cruz) followed by goat anti-rabbit biotinylated secondary antibody (326-UR; Biogenex Laboratories, San Ramon, CA, USA) and streptavidin-horseradish peroxidase (Pharmingen, San Diego, CA, USA) in a solution of 3,3′-diaminobenzidine tetrahydrochloride. Sections were counterstained with hematoxylin.
Statistical analyses
The data were analyzed by ANOVA and post hoc Tukey test. Microarray data were analyzed as described above.
RESULTS
Prenatal choline availability modifies the rate of tumor growth
The rats began to develop palpable tumors ~40 days after treatment with DMBA; this latency and subsequent incidence were not affected by the prenatal diet (data not shown). Approximately 70% of animals in all groups developed tumors by the last day of study, i.e., 162 days post-treatment (age P227) (prenatally choline-deficient 67%, controls 67%, prenatally choline-supplemented 73%). No animals treated with the vehicle (oil) developed tumors. For humane reasons, our protocol did not allow animals to bear tumors larger than 3 cm in diameter. Rats that developed a tumor of this size were euthanized, and their tissues were collected. Remarkably, prenatally choline-deficient rats had the fastest growing tumors, i.e., they required the shortest average period of time to develop a 3-cm tumor from the time of diagnosis (Fig. 1). On average, in prenatally choline-deficient rats, these fast-growing tumors required 28 days to reach 3 cm, whereas the tumors from prenatally choline-supplemented animals took 43 days, i.e., over 50% longer (Fig. 1). The tumors from control rats grew at an intermediate rate. Tumors were collected from all subjects, and histological analysis was performed on hematoxylin-and-eosin-stained sections. As expected, almost all of the tumors were papillary adenocarcinomas. One tumor from 4 animals in each of the dietary groups was used for microarray gene expression analysis using Illumina Rat Ref-12 BeadChips.
Prenatal availability of choline modulates mammary tumor growth. During E11–17, pregnant rats consumed varying amounts of choline (Sup, supplemented; Con, control; Def, deficient). Offspring were treated with DMBA on P65. Tumors were monitored until P227, and rats were euthanized before P227 if they developed a tumor of 3 cm in diameter. Average time period (disease duration) to develop a 3-cm tumor is shown. Diet effect was statistically significant (P<0.04; ANOVA), and tumors from prenatally choline-supplemented rats grew more slowly (longer disease duration) than those in prenatally choline-deficient rats (P<0.04; Tukey test).
Prenatal choline availability modifies patterns of gene expression
Prenatal intake of choline modified the expression of multiple genes. On the basis of our analysis criteria (FDR<25%), the final set of differentially expressed genes contained 72 members, and cluster analysis showed that they fit into three distinct groups consistent with the availability of choline in the maternal diet (Fig. 2). Thus, prenatal choline intake was a predictor of the molecular phenotype of the mammary neoplasms. Significantly, a large proportion (over 30%) of these differentially expressed genes has been implicated in cancer biology (see Fig. 2, gene symbols marked by an asterisk).
Hierarchal clustering of arrays and genes expressed in tumors. RNA (4/group) was analyzed as described in Materials and Methods. Red represents high expression and blue low expression, relative to mean (white) (see key at right). Arrays from the 3 groups were differentiated from each other (s, prenatally choline-supplemented; c, control; d, prenatally choline-deficient). Genes in left cluster (underscored) and right cluster (double underscored) are described in text. Asterisk denotes genes known to be dysregulated in human cancer (see text).
There were 20 genes whose expression was high in the slow-growing tumors from the prenatally choline-supplemented rats (Fig. 2, right cluster). Strikingly, 8 (40%) of these genes encode proteins involved in protein synthesis: 7 ribosomal proteins i.e., Rps6, Rps10, Rpl21, Rps4x, Rpl37a, Rpl15, and Rpl23a and the eukaryotic translation elongation factor 1 alpha 1 (Eef1a1). The latter is a putative oncogene (26). In contrast, the expression of a ribosome synthesis factor, Emg1 (27), was relatively low in these tumors (Fig. 2, left cluster). Interestingly, a previous study showed that the expression of mRNAs for multiple ribosomal proteins is up-regulated in normal appearing rat mammary glands during the preneoplastic period following the administration of the carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) (28), and the PhIP-evoked mammary tumors have higher expression of these mRNAs, as compared to those induced by the administration of DMBA (29). Two Krüppel family transcription factors were also highly expressed in these tumors. Krüppel-like factor 9 (Klf9) can negatively regulate the activity of estrogen receptor-α (ESR1) (30), suggesting that the estrogen-stimulated growth pathway may be attenuated in these tumors. Another member of this family, Klf6, is a tumor suppressor (31). The expression of the clock gene (period homologue 1) Per1, is reduced in breast tumors as compared to normal tissue (32), and overexpression of PER1 in breast and other cancer cell lines slows their growth (33). High expression of netrin 4 (Ntn4), a member of a family of neural guidance factors, in human breast tumors is associated with longer patient survival (34). Two transcripts encode components of the G protein-regulated pathways that are reportedly overexpressed in breast cancer: the regulator of G protein signaling 2 (Rgs2) (35) and phospholipase Cβ2 (Plcb2) (36). Three genes in this cluster encode proteins that belong to a set of factors postulated as modulators of breast cancer progression and metastasis, collectively referred to as the “diasporin pathway” (37). These are Luc7-like (Luc7l), thioredoxin-interacting protein (Txnip; VDUP1; TBP2), and nidogen 2 (Nid2). Txnip is a putative tumor suppressor gene (38), and Nid2 is reportedly down-regulated in gastrointestinal cancers via DNA methylation (39). Another member of the diasporin pathway is the receptor for colony-stimulating factor 1 (Csf1r). We found that the expression of Csf1 is relatively low in these tumors (Fig. 2, left cluster). High expression of CSF1 and its receptor in breast cancer correlates with tumor invasiveness and poor prognosis (40). In summary, the pattern of expression of cancer-related genes in this cluster is largely consistent with a relatively slow growth of the tumors in the prenatally choline-supplemented rats.
The expression of 32 genes was up-regulated in the tumors derived from the prenatally choline-deficient rats, i.e., the fast-growing tumors (Fig. 2, left cluster). This set was enriched by transcripts encoding mitochondrial proteins, including: mitochondrial ribosomal proteins (Mrpl49 and Mrps34), NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 12 (Ndufa12), carnitine palmitoyltransferase 2 (Cpt2), and enoyl coenzyme A hydratase, short chain, 1 (Echs1). Interestingly, the expression of the ECHS1 protein is reportedly high in prostate cancer (41). Note also that the expression of the mitochondrial transcription factor B1 (Tfb1m) was relatively low in these tumors (Fig. 2, right cluster). In addition to these proteins that function in cellular bioenergetics, we observed up-regulation of expression of mRNA encoding a glycolytic enzyme, triosephosphate isomerase 1 (Tpi1). The abundance of this transcript is reportedly higher in the ductal as compared to lobular breast tumors (42). Several genes in this cluster encode proteins that function in cell adhesion, membrane trafficking, and cytoskeleton dynamics in a manner regulated by GTP binding and hydrolysis. These include amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein (Apbb1ip; RIAM, RARP1), ADP-ribosylation factor 4 (Arf4), breast cancer antiestrogen resistance 3 (Bcar3) (43) (see below), and charged multivesicular body protein 2a (chromatin-modifying protein 2a) (Chmp2a, mVps2). Additional genes that function in cell adhesion, cell-cell contact, and migration, whose expression is up-regulated in this cluster included galectin 3 (Lgals3) and its ligand Ly6/Plaur domain containing 3 (Lypd3; C4.4a), as well as claudin 12 (Cldn12). Up-regulated expression of galectin 3 occurs in multiple cancers, including breast cancer (44), although its high expression may be a sign of reduced malignancy in the latter (44). A recent study found that high expression of galectin 3 is a feature of breast cancer metastases to the brain (45). Interestingly, reducing the expression of choline kinase with an RNAi strategy in malignant human breast cancer cell lines lowered the levels of galectin 3 protein and slowed cell growth (46), suggesting a relationship between choline metabolism and galectin 3 expression. LYPD3 (C4.4A), a ligand of galectin 3, is a postulated tumor marker for colon cancer (47). Several claudins (proteins in tight junctions) are overexpressed in cancers, and high expression of CLDN12 is frequently seen in colon cancer (48). Four genes in this cluster encode proteins that regulate cell division and DNA dynamics. These included regulator of chromosome condensation 2 (Rcc2, TD-40), SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily b, member 1 (Smarcb1), expressed in nonmetastatic cells (Nme1), and stratifin 14–3-3σ (Sfn). SMARCB1 is part of the SWI/SNF complex that modulates chromatin structure and a tumor suppressor (49). NME1 (NM23, NM23-H1) was the first suppressor of metastasis to be identified (50). The protein has multiple activities, including DNA binding; however, it is not clear what molecular function is responsible for its apparent antimetastatic action (51). High expression of NME1 in tumors correlated with better survival of breast cancer patients (52). In contrast, overexpression of NME1 in neuroblastoma was associated with poor prognosis (53). SFN, induced by tumor suppressor protein p53 in response to DNA damage, inhibits cells cycle (54) and is frequently down-regulated in breast cancers by an epigenetic mechanism (55) (see below). Note, however that SFN is overexpressed in other cancers, e.g., pancreas (56, 57), indicating that in addition to its tumor suppressor activity, it may have other actions in neoplasia. Finally, there were three genes encoding proteins that participate in cell-cell signaling by stimulating growth. Two of those genes encode enzymes that act sequentially to synthesize prostaglandin E2 (PGE2): prostaglandin endoperoxide synthase 1 (Ptgs1; cyclooxygenase 1, Cox1) and prostaglandin E synthase 2 (Ptges2). It has been postulated that PGE2 promotes tumorigenesis (58), and cyclooxygenase inhibitors (predominantly COX2 inhibitors) have potential as anticancer drugs (58) and inhibit growth of rat mammary tumors in the DMBA model (59). The tumors from prenatally choline-deficient rats also overexpressed Jagged 1 (Jag1), a ligand for Notch, whose high expression in breast cancer is associated with poor prognosis (60) (see below).
Jagged1, Bcar3, and Stratifin proteins are overexpressed in tumors from prenatally choline-deficient rats
On the basis of the microarray data, we selected three genes, whose expression was relatively high in the fast-growing tumors typically seen in the prenatally choline-deficient rats, for further evaluation, including Jag1, Bcar3, and Sfn. RT-PCR analyses of these mRNAs confirmed the microarray data (Figs. 3A, ,4A,4A, and and5A).5A). Moreover, JAG1 protein levels were 4-fold higher in tumors from the prenatally choline-deficient rats as compared to those from the prenatally choline-supplemented animals (Fig. 3B). Immunohistochemical analysis showed that JAG1 was expressed in the epithelial cells and in cancer cells with presumed epithelial origin (Fig. 3C, D)—consistent with previous observations of human breast tissue (61) and tumors (60). Staining in the stroma was poor. There was no effect of the prenatal diet on this staining pattern. The quantitative difference in the abundance of JAG1 protein revealed by immunoblots was not apparent in immunohistochemical images—a result not unexpected, given that our staining conditions using peroxidase-diaminobenzidine method of antigen visualization were not optimized for quantitation. The abundance of the BCAR3 protein was 3.6-fold higher in the tumors from the prenatally choline-deficient rats as compared to those from the prenatally choline-supplemented animals (Fig. 4B). BCAR3 confers antiestrogen drug (e.g., tamoxifen) resistance in breast cancer cells and is thought to participate in the transition to estrogen independence during disease progression (62). Expression of SFN was almost 2-fold higher in the tumors from the prenatally choline-deficient rats as compared to those from the other dietary groups (Fig. 5B).
Expression of Jagged 1 in mammary tumors. A) RT-PCR analysis of mRNA in tumors used for microarray studies. Diet effect was statistically significant (P<0.04; ANOVA), and amount of Jag1 mRNA was higher in tumors from prenatally choline-deficient rats as compared to controls (P<0.05; Tukey test). Inset: example RT-PCR products for Jag1 and β-actin. B) Immunoblot analysis of JAG1 protein (n=8/group). Diet effect was statistically significant (P<0.0002; ANOVA), and all pairwise comparisons were significant (P<0.05; Tukey test). Inset: example immunoblot. C, D) Immunohistochemical analysis of JAG1 (objective ×20). C) Tumor from a prenatally choline-deficient rat. Inset: apparently normal-appearing structure from this tumor showing JAG1 staining confined primarily to the epithelial cells. D) Tumor from a prenatally choline-supplemented rat. S, prenatally choline-supplemented; C, control; D, prenatally choline-deficient.
Expression of BCAR3 in mammary tumors. A) RT-PCR analysis of mRNA in tumors used for microarray studies. Diet effect was statistically significant (P<0.0002; ANOVA), and amount of Bcar3 mRNA was lower in tumors from prenatally choline-supplemented rats as compared to each of the other two groups (P<0.001; Tukey test). Inset: example RT-PCR products for Bcar3 and β-actin. B) Immunoblot analysis of BCAR3 protein (n=8/group). Diet effect was statistically significant (P<0.001; ANOVA), and amount of BCAR3 was lower in tumors from prenatally choline-supplemented rats as compared to each of the other two groups (P<0.03; Tukey test). Inset: example immunoblot. S, prenatally choline-supplemented; C, control; D, prenatally choline-deficient.
Expression and DNA methylation of Stratifin in mammary tumors. A) RT-PCR analysis of mRNA in tumors used for microarray studies. Diet effect was statistically significant (P<0.002; ANOVA), and amount of Sfn mRNA was higher in tumors from prenatally choline-deficient rats as compared to each of the other two groups (P<0.05; Tukey test). Inset: example RT-PCR products for Sfn and β-actin. B) Immunoblot analysis of SFN protein (n=4/group). Diet effect was statistically significant (P<0.00003; ANOVA), and amount of SFN was higher in tumors from prenatally choline-deficient rats as compared to each of the other two groups (P<0.001; Tukey test). Inset: example immunoblot. C) MSP analysis of DNA methylation of CpG island within exon 1. Diet effect was statistically significant (P<0.0002; ANOVA), and Sfn gene was more highly methylated in tumors from prenatally choline-supplemented rats as compared to each of the other two groups (P<0.02; Tukey test). Inset: example PCR products obtained using primers designed to amplify methylated (m) and unmethylated (u) DNA templates. D) Correlation analysis of relation between Sfn DNA methylation and its mRNA expression. S, prenatally choline-supplemented; C, control; D, prenatally choline-deficient.
DNA methylation of the Sfn gene in mammary tumors is proportional to the prenatal intake of choline
Hypermethylation and the resultant down-regulation of expression of the SFN gene have been repeatedly documented in human breast tumors (55, 63, 64), and we (19) and others (20) previously showed that prenatal availability of choline modulates DNA methylation in a gene-specific manner. We assessed DNA methylation of the CpG island within the first exon of Sfn using MSP. Tumor DNA methylation within this region was proportional to the amount of choline in the maternal diet (Fig. 5C), and there was a highly significant inverse correlation between Sfn mRNA levels and Sfn DNA methylation (Fig. 5D).
DISCUSSION
The results reported here show that raising the maternal dietary choline from a deficient state to a moderately high intake during the second half of pregnancy in rats slows down the growth of mammary tumors induced later in life by the administration of DMBA in female offspring. This was not accompanied by altered latency, incidence, or multiplicity of tumors, suggesting that choline availability did not alter the events associated with initiation of tumorigenesis. Prior studies on gestational nutrition and mammary carcinogenesis in rats focused primarily on fat intake (5, 65, 66) and suggested that high-fat diets increased the risk of neoplasia, possibly by raising maternal estrogen synthesis, resulting in the exposure of the fetuses to elevated plasma estrogen concentrations. We found no effect of prenatal choline exposure on the age of puberty—a maternal diet-susceptible (67) index of estrogen action (vaginal opening postnatal day ± sd: controls, 33.8±1.9; prenatally choline-deficient, 32.8±1.8; prenatally choline-supplemented, 33.1±2.6)—suggesting that it had no effect on circulating estrogens.
The intake of choline during pregnancy strongly influenced the gene expression patterns of the tumors. This pattern was particularly distinctive in neoplasms derived from offspring of the prenatally choline-supplemented rats, as compared to those in the controls and the prenatally choline-deficient animals whose mRNA expression profiles were more alike (Fig. 2, dendrogram). These data are consistent with previous reports (19, 68) that postulated that the diet designated as “control” supplies subadequate amounts of choline for a pregnant animal that has high demands for this nutrient, making the gene expression pattern in the control group similar to that of the prenatally choline-deficient one (19).
Transcription profiling of primary breast cancers in women has provided sets of gene expression signatures with sufficiently high predictive and prognostic value to be used in the clinic (69). In animal studies, transcriptomes of the normal gland relative to cancer or those found in tumors evoked by particular oncogenes (e.g., ref. 70) or treatment with chemical carcinogens (71,72,73,74) have been compared. Our approach would tend to reveal those genes whose expression is affected by the prenatal diet rather than those modulated by the carcinogen or neoplastic process per se. Remarkably, however, the distinct gene expression signature of the slow-growing tumors seen in the prenatally choline-supplemented rats was characterized by high expression of genes known to arrest breast cancer progression and/or improve survival in human patients, including, Klf6, Klf9, Nid2, Ntn4, Per1, and Txnip, concomitant with the low expression of genes associated with accelerated cancer progression and/or poor prognosis, i.e., Bcar3, Cldn12, Csf1, Jag1, Lgals3, Lypd3, Nme1, Ptges2, Ptgs1, and Smarcb1. Thus, multiple quantitative gene expression traits in these tumors are consistent with their growth characteristics. It is noteworthy that these distinct gene expression signatures imply probable differences in responses of these tumors to various therapeutic agents. Although tumor tissue is heterogeneous, we posit that the changes in mRNA and protein levels reported here are due to alterations in the abundance of these species per cell (i.e., true changes in expression) rather than differences in the tissue abundance of cell types that express them. For example, JAG1 is expressed only in the cancer cells and not in the stroma (Fig. 3)—a result consistent with previous studies showing that DMBA-evoked tumorigenesis targets epithelial cells (75). It is also possible that changes in the expression of some of the genes observed here occurred in stromal cells that, in turn, may have influence on the growth rate of the carcinoma (76, 77).
In addition to the above-listed genes, two sets of functionally related, i.e., mitochondrial and ribosomal, transcripts were reciprocally regulated and distinguished the three classes of tumors, defined by the prenatal diet. While we do not know whether these differences in gene expression are predictive of energy status and/or protein synthesis in the tumors, cancer progression correlated better with the high mitochondrial gene expression profile than with the translational one. It is also possible, however, that although the tumors from the prenatally choline-supplemented rats overexpressed multiple mRNAs for ribosomal proteins, they had slow translation rates, as indicated by low expression of Emg1 (Essential for mitotic growth 1, homologue) (Fig. 2, left cluster)—a factor indispensable for ribosomal assembly (27). Our data are also consistent with studies in zebrafish showing that multiple ribosomal proteins may act as tumor suppressors (78).
As noted above, we had no evidence for changes in estrogen levels in the prepubertal rats due to their fetal exposure to choline; however, the tumors from the prenatally choline-deficient rats might be hyperresponsive to normal levels of circulating estrogens because of low Klf9 (30) and high BCAR3 expression (79).
We investigated the methylation of the stratifin gene because SFN expression is reduced in breast cancers (55), inhibited by methylation of regulatory CpGs (55, 80), and hypermethylation of SFN is common in breast cancer, in early breast lesions, and is seen even in normally appearing breast tissues in the vicinity of the tumor (64). Thus, SFN hypermethylation may constitute an early, perhaps a developmental, event that would be present in the gland prior to neoplastic transformation. Our Sfn methylation data are consistent with the idea that prenatal supply of choline may modulate DNA methylation of developing mammary cells, thereby creating an epigenetic setting within which subsequent neoplastic (both genetic and epigenetic) events take place. Indeed, in mice, gestational consumption of diets highly enriched in metabolic methyl group donors and cofactors (choline, betaine, methionine, folic acid, and vitamin B12) has a dramatic effect on the phenotype of offspring mediated by changes in methylation and expression of the relevant genes [e.g., Avy (81) and AxinFu (82)].
Together, our data show that the amount of choline consumed by a pregnant mother confers a predisposition to a phenotypically and clinically distinct type of mammary carcinoma in her daughters. It is tempting to extrapolate these results to humans. Women consuming high amounts of choline have reduced risk of breast cancer (8). There is a considerable genetic polymorphism in genes encoding enzymes related to the metabolism of choline and methyl groups (12). The expression of one of those genes, PEMT, which encodes phosphatidylethanolamine N-methyltransferase, which synthesizes the choline molecule de novo, is up-regulated by estrogens (83); the minor C allele of the PEMT rs12325817 polymorphism was associated with increased breast cancer risk; and an almost 2-fold increase of risk was found in women with the PEMT rs7946 genotype combined with lowest dietary betaine intake (8). Thus, the interplay between mother’s genetic background and dietary choline supply in pregnancy may influence the predisposition to a particular type of cancer in her offspring. In conclusion, our data point to the heretofore unanticipated role of adequate choline nutrition during pregnancy in prevention of breast cancer in adult daughters.
Acknowledgments
We thank Adam Lerner for the anti-BCAR3 antibody and Patrick Hogan and Bethany Shade for assistance. The Molecular Genetics Core Facility at Children’s Hospital Boston performed the microarray analysis. These studies were supported by National Institute of Health grants CA120488 and AG009525.
References
- Russo J, Russo I H. Development of the human mammary gland. Neville M C, Daniel C W, editors. New York, NY, USA: Plenum Press; The Mammary GlandDevelopment, Regulation and Function. 1987:67–93. [Google Scholar]
- Trichopoulos D. Hypothesis: does breast cancer originate in utero? Lancet. 1990;335:939–940. [Abstract] [Google Scholar]
- Xue F, Michels K B. Intrauterine factors and risk of breast cancer: a systematic review and meta-analysis of current evidence. Lancet Oncol. 2007;8:1088–1100. [Abstract] [Google Scholar]
- Hilakivi-Clarke L, de Assis S. Fetal origins of breast cancer. Trends Endocrinol Metab. 2006;17:340–348. [Abstract] [Google Scholar]
- Hilakivi-Clarke L, Clarke R, Onojafe I, Raygada M, Cho E, Lippman M. A maternal diet high in n-6 polyunsaturated fats alters mammary gland development, puberty onset, and breast cancer risk among female rat offspring. Proc Natl Acad Sci U S A. 1997;94:9372–9377. [Europe PMC free article] [Abstract] [Google Scholar]
- Russo J, Gusterson B A, Rogers A E, Russo I H, Wellings S R, van Zwieten M J. Comparative study of human and rat mammary tumorigenesis. Lab Invest. 1990;62:244–278. [Abstract] [Google Scholar]
- Food and Nutrition Board Washington, D.C., USA: National Academy Press; Dietary Reference Intakes for Thiamin, Riboflavin, Niacin, Vitamin B6, Folate, Vitamin B12, Panthotenic Acid, Biotin, and Choline. 1998 [Abstract] [Google Scholar]
- Xu X, Gammon M D, Zeisel S H, Lee Y L, Wetmur J G, Teitelbaum S L, Bradshaw P T, Neugut A I, Santella R M, Chen J. Choline metabolism and risk of breast cancer in a population-based study. FASEB J. 2008;22:2045–2052. [Europe PMC free article] [Abstract] [Google Scholar]
- Shaw G M, Carmichael S L, Yang W, Selvin S, Schaffer D M. Periconceptional dietary intake of choline and betaine and neural tube defects in offspring. Am J Epidemiol. 2004;160:102–109. [Abstract] [Google Scholar]
- Blusztajn J K. Choline, a vital amine. Science. 1998;281:794–795. [Abstract] [Google Scholar]
- McCann J C, Hudes M, Ames B N. An overview of evidence for a causal relationship between dietary availability of choline during development and cognitive function in offspring. Neurosci Biobehav Rev. 2006;30:696–712. [Abstract] [Google Scholar]
- Zeisel S H. Choline: critical role during fetal development and dietary requirements in adults. Annu Rev Nutr. 2006;26:229–250. [Europe PMC free article] [Abstract] [Google Scholar]
- Meck W H, Williams C L, Cermak J M, Blusztajn J K. Developmental periods of choline sensitivity provide an ontogenetic mechanism for regulating memory capacity and age-related dementia. Front Integr Neurosci. 2008;1:7. [Europe PMC free article] [Abstract] [Google Scholar]
- Meck W H, Williams C L. Simultaneous temporal processing is sensitive to prenatal choline availability in mature and aged rats. Neuroreport. 1997;8:3045–3051. [Abstract] [Google Scholar]
- Meck W H, Williams C L. Choline supplementation during prenatal development reduces proactive interference in spatial memory. Brain Res Dev Brain Res. 1999;118:51–59. [Abstract] [Google Scholar]
- Mellott T J, Follettie M T, Diesl V, Hill A A, Lopez-Coviella I, Blusztajn J K. Prenatal choline availability modulates hippocampal and cerebral cortical gene expression. FASEB J. 2007;21:1311–1323. [Abstract] [Google Scholar]
- Jaenisch R, Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet. 2003;33:245–254. [Abstract] [Google Scholar]
- Jones P A, Baylin S B. The epigenomics of cancer. Cell. 2007;128:683–692. [Europe PMC free article] [Abstract] [Google Scholar]
- Kovacheva V P, Mellott T J, Davison J M, Wagner N, Lopez-Coviella I, Schnitzler A C, Blusztajn J K. Gestational choline deficiency causes global and Igf2 gene DNA hypermethylation by up-regulation of Dnmt1 expression. J Biol Chem. 2007;282:31777–31788. [Abstract] [Google Scholar]
- Niculescu M D, Craciunescu C N, Zeisel S H. Dietary choline deficiency alters global and gene-specific DNA methylation in the developing hippocampus of mouse fetal brains. FASEB J. 2006;20:43–49. [Europe PMC free article] [Abstract] [Google Scholar]
- Hennighausen L, Robinson G W. Signaling pathways in mammary gland development. Dev Cell. 2001;1:467–475. [Abstract] [Google Scholar]
- Thompson H J. Methods for the induction of mammary carcinogenesis in the rat using either 7,12-dimethylben[α]anthracene or 1-methyl-nitrosourea. Ip M M, Asch B B, editors. New York, NY, USA: Kluwer Academic/Plenum Publishers; Methods in Mammary Gland Biology and Breast Cancer Res. 2000:19–30. [Google Scholar]
- Tusher V G, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A. 2001;98:5116–5121. [Europe PMC free article] [Abstract] [Google Scholar]
- Eisen M B, Spellman P T, Brown P O, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A. 1998;95:14863–14868. [Europe PMC free article] [Abstract] [Google Scholar]
- Li L C, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002;18:1427–1431. [Abstract] [Google Scholar]
- Thornton S, Anand N, Purcell D, Lee J. Not just for housekeeping: protein initiation and elongation factors in cell growth and tumorigenesis. J Mol Med. 2003;81:536–548. [Abstract] [Google Scholar]
- Liu P C, Thiele D J. Novel stress-responsive genes EMG1 and NOP14 encode conserved, interacting proteins required for 40S ribosome biogenesis. Mol Biol Cell. 2001;12:3644–3657. [Europe PMC free article] [Abstract] [Google Scholar]
- Shan L, Yu M, Schut H A, Snyderwine E G. Susceptibility of rats to mammary gland carcinogenesis by the food-derived carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) varies with age and is associated with the induction of differential gene expression. Am J Pathol. 2004;165:191–202. [Europe PMC free article] [Abstract] [Google Scholar]
- Kuramoto T, Morimura K, Yamashita S, Okochi E, Watanabe N, Ohta T, Ohki M, Fukushima S, Sugimura T, Ushijima T. Etiology-specific gene expression profiles in rat mammary carcinomas. Cancer Res. 2002;62:3592–3597. [Abstract] [Google Scholar]
- Velarde M C, Zeng Z, McQuown J R, Simmen F A, Simmen R C. Kruppel-like factor 9 is a negative regulator of ligand-dependent estrogen receptor alpha signaling in Ishikawa endometrial adenocarcinoma cells. Mol Endocrinol. 2007;21:2988–3001. [Abstract] [Google Scholar]
- Buendia M A. Tumor suppressors in hepatocellular carcinoma: many are called, but few are chosen. J Hepatol. 2007;46:546–548. [Abstract] [Google Scholar]
- Winter S L, Bosnoyan-Collins L, Pinnaduwage D, Andrulis I L. Expression of the circadian clock genes Per1 and Per2 in sporadic and familial breast tumors. Neoplasia. 2007;9:797–800. [Europe PMC free article] [Abstract] [Google Scholar]
- Gery S, Komatsu N, Baldjyan L, Yu A, Koo D, Koeffler H P. The circadian gene per1 plays an important role in cell growth and DNA damage control in human cancer cells. Mol Cell. 2006;22:375–382. [Abstract] [Google Scholar]
- Esseghir S, Kennedy A, Seedhar P, Nerurkar A, Poulsom R, Reis-Filho J S, Isacke C M. Identification of NTN4, TRA1, and STC2 as prognostic markers in breast cancer in a screen for signal sequence encoding proteins. Clin Cancer Res. 2007;13:3164–3173. [Abstract] [Google Scholar]
- Smalley M J, Iravani M, Leao M, Grigoriadis A, Kendrick H, Dexter T, Fenwick K, Regan J L, Britt K, McDonald S, Lord C J, Mackay A, Ashworth A. Regulator of G-protein signalling 2 mRNA is differentially expressed in mammary epithelial subpopulations and over-expressed in the majority of breast cancers. Breast Cancer Res. 2007;9:R85. [Europe PMC free article] [Abstract] [Google Scholar]
- Bertagnolo V, Benedusi M, Querzoli P, Pedriali M, Magri E, Brugnoli F, Capitani S. PLC-β2 is highly expressed in breast cancer and is associated with a poor outcome: a study on tissue microarrays. Int J Oncol. 2006;28:863–872. [Abstract] [Google Scholar]
- Crawford N P, Walker R C, Lukes L, Officewala J S, Williams R W, Hunter K W. The Diasporin Pathway: a tumor progression-related transcriptional network that predicts breast cancer survival. Clin Exp Metastasis. 2008;25:357–369. [Europe PMC free article] [Abstract] [Google Scholar]
- Kim S Y, Suh H W, Chung J W, Yoon S R, Choi I. Diverse functions of VDUP1 in cell proliferation differentiation, and diseases. Cell Mol Immunol. 2007;4:345–351. [Abstract] [Google Scholar]
- Ulazzi L, Sabbioni S, Miotto E, Veronese A, Angusti A, Gafa R, Manfredini S, Farinati F, Sasaki T, Lanza G, Negrini M. Nidogen 1 and 2 gene promoters are aberrantly methylated in human gastrointestinal cancer. Mol Cancer. 2007;6:17. [Europe PMC free article] [Abstract] [Google Scholar]
- Sapi E. The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med. 2004;229:1–11. [Abstract] [Google Scholar]
- Lin J F, Xu J, Tian H Y, Gao X, Chen Q X, Gu Q, Xu G J, Song J D, Zhao F K. Identification of candidate prostate cancer biomarkers in prostate needle biopsy specimens using proteomic analysis. Int J Cancer. 2007;121:2596–2605. [Abstract] [Google Scholar]
- Korkola J E, DeVries S, Fridlyand J, Hwang E S, Estep A L, Chen Y Y, Chew K L, Dairkee S H, Jensen R M, Waldman F M. Differentiation of lobular versus ductal breast carcinomas by expression microarray analysis. Cancer Res. 2003;63:7167–7175. [Abstract] [Google Scholar]
- Cai D, Iyer A, Felekkis K N, Near R I, Luo Z, Chernoff J, Albanese C, Pestell R G, Lerner A. AND-34/BCAR3, a GDP exchange factor whose overexpression confers antiestrogen resistance, activates Rac, PAK1, and the cyclin D1 promoter. Cancer Res. 2003;63:6802–6808. [Abstract] [Google Scholar]
- Dumic J, Dabelic S, Flogel M. Galectin-3: an open-ended story. Biochim Biophys Acta. 2006;1760:616–635. [Abstract] [Google Scholar]
- Mayoral M A, Mayoral C, Meneses A, Villalvazo L, Guzman A, Espinosa B, Ochoa J L, Zenteno E, Guevara J. Identification of galectin-3 and mucin-type O-glycans in breast cancer and its metastasis to brain. Cancer Invest. 2008;26:615–623. [Abstract] [Google Scholar]
- Glunde K, Raman V, Mori N, Bhujwalla Z M. RNA interference-mediated choline kinase suppression in breast cancer cells induces differentiation and reduces proliferation. Cancer Res. 2005;65:11034–11043. [Abstract] [Google Scholar]
- Paret C, Hildebrand D, Weitz J, Kopp-Schneider A, Kuhn A, Beer A, Hautmann R, Zoller M. C4.4A as a candidate marker in the diagnosis of colorectal cancer. Br J Cancer. 2007;97:1146–1156. [Europe PMC free article] [Abstract] [Google Scholar]
- Grone J, Weber B, Staub E, Heinze M, Klaman I, Pilarsky C, Hermann K, Castanos-Velez E, Ropcke S, Mann B, Rosenthal A, Buhr H J. Differential expression of genes encoding tight junction proteins in colorectal cancer: frequent dysregulation of claudin-1, -8 and -12. Int J Colorectal Dis. 2007;22:651–659. [Abstract] [Google Scholar]
- Roberts C W, Orkin S H. The SWI/SNF complex–chromatin and cancer. Nat Rev Cancer. 2004;4:133–142. [Abstract] [Google Scholar]
- Steeg P S, Bevilacqua G, Kopper L, Thorgeirsson U P, Talmadge J E, Liotta L A, Sobel M E. Evidence for a novel gene associated with low tumor metastatic potential. J Natl Cancer Inst. 1988;80:200–204. [Abstract] [Google Scholar]
- Ouatas T, Salerno M, Palmieri D, Steeg P S. Basic and translational advances in cancer metastasis: Nm23. J Bioenerg Biomembr. 2003;35:73–79. [Abstract] [Google Scholar]
- Heimann R, Hellman S. Individual characterisation of the metastatic capacity of human breast carcinoma. Eur J Cancer. 2000;36:1631–1639. [Abstract] [Google Scholar]
- Leone A, Seeger R C, Hong C M, Hu Y Y, Arboleda M J, Brodeur G M, Stram D, Slamon D J, Steeg P S. Evidence for nm23 RNA overexpression, DNA amplification and mutation in aggressive childhood neuroblastomas. Oncogene. 1993;8:855–865. [Abstract] [Google Scholar]
- Hermeking H, Lengauer C, Polyak K, He T C, Zhang L, Thiagalingam S, Kinzler K W, Vogelstein B. 14–3σ-3 sigma is a p53-regulated inhibitor of G2/M progression. Mol Cell. 1997;1:3–11. [Abstract] [Google Scholar]
- Ferguson A T, Evron E, Umbricht C B, Pandita T K, Chan T A, Hermeking H, Marks J R, Lambers A R, Futreal P A, Stampfer M R, Sukumar S. High frequency of hypermethylation at the 14–3σ-3 sigma locus leads to gene silencing in breast cancer. Proc Natl Acad Sci U S A. 2000;97:6049–6054. [Europe PMC free article] [Abstract] [Google Scholar]
- Iacobuzio-Donahue C A, Ashfaq R, Maitra A, Adsay N V, Shen-Ong G L, Berg K, Hollingsworth M A, Cameron J L, Yeo C J, Kern S E, Goggins M, Hruban R H. Highly expressed genes in pancreatic ductal adenocarcinomas: a comprehensive characterization and comparison of the transcription profiles obtained from three major technologies. Cancer Res. 2003;63:8614–8622. [Abstract] [Google Scholar]
- Friess H, Ding J, Kleeff J, Fenkell L, Rosinski J A, Guweidhi A, Reidhaar-Olson J F, Korc M, Hammer J, Buchler M W. Microarray-based identification of differentially expressed growth- and metastasis-associated genes in pancreatic cancer. Cell Mol Life Sci. 2003;60:1180–1199. [Abstract] [Google Scholar]
- Thorat M A, Morimiya A, Mehrotra S, Konger R, Badve S S. Prostanoid receptor EP1 expression in breast cancer. Mod Pathol. 2008;21:15–21. [Abstract] [Google Scholar]
- Alshafie G A, Abou-Issa H M, Seibert K, Harris R E. Chemotherapeutic evaluation of Celecoxib, a cyclooxygenase-2 inhibitor, in a rat mammary tumor model. Oncol Rep. 2000;7:1377–1381. [Abstract] [Google Scholar]
- Dickson B C, Mulligan A M, Zhang H, Lockwood G, O'Malley F P, Egan S E, Reedijk M. High-level JAG1 mRNA and protein predict poor outcome in breast cancer. Mod Pathol. 2007;20:685–693. [Abstract] [Google Scholar]
- Stylianou S, Clarke R B, Brennan K. Aberrant activation of notch signaling in human breast cancer. Cancer Res. 2006;66:1517–1525. [Abstract] [Google Scholar]
- Yu Y, Feig L A. Involvement of R-Ras and Ral GTPases in estrogen-independent proliferation of breast cancer cells. Oncogene. 2002;21:7557–7568. [Abstract] [Google Scholar]
- Jeronimo C, Monteiro P, Henrique R, Dinis-Ribeiro M, Costa I, Costa V L, Filipe L, Carvalho A L, Hoque M O, Pais I, Leal C, Teixeira M R, Sidransky D. Quantitative hypermethylation of a small panel of genes augments the diagnostic accuracy in fine-needle aspirate washings of breast lesions. Breast Cancer Res Treat. 2008;109:27–34. [Abstract] [Google Scholar]
- Umbricht C B, Evron E, Gabrielson E, Ferguson A, Marks J, Sukumar S. Hypermethylation of 14–3σ-3 sigma (stratifin) is an early event in breast cancer. Oncogene. 2001;20:3348–3353. [Abstract] [Google Scholar]
- Hilakivi-Clarke L, Onojafe I, Raygada M, Cho E, Clarke R, Lippman M E. Breast cancer risk in rats fed a diet high in n-6 polyunsaturated fatty acids during pregnancy. J Natl Cancer Inst. 1996;88:1821–1827. [Abstract] [Google Scholar]
- Stark A H, Kossoy G, Zusman I, Yarden G, Madar Z. Olive oil consumption during pregnancy and lactation in rats influences mammary cancer development in female offspring. Nutr Cancer. 2003;46:59–65. [Abstract] [Google Scholar]
- Lewis E M, Barnett J F, Jr, Freshwater L, Hoberman A M, Christian M S. Sexual maturation data for Crl Sprague-Dawley rats: criteria and confounding factors. Drug Chem Toxicol. 2002;25:437–458. [Abstract] [Google Scholar]
- Zeisel S H, Mar M H, Zhou Z, da Costa K A. Pregnancy and lactation are associated with diminished concentrations of choline and its metabolites in rat liver. J Nutr. 1995;125:3049–3054. [Abstract] [Google Scholar]
- Fan C, Oh D S, Wessels L, Weigelt B, Nuyten D S, Nobel A B, van't Veer L J, Perou C M. Concordance among gene-expression-based predictors for breast cancer. N Engl J Med. 2006;355:560–569. [Abstract] [Google Scholar]
- Desai K V, Xiao N, Wang W, Gangi L, Greene J, Powell J I, Dickson R, Furth P, Hunter K, Kucherlapati R, Simon R, Liu E T, Green J E. Initiating oncogenic event determines gene-expression patterns of human breast cancer models. Proc Natl Acad Sci U S A. 2002;99:6967–6972. [Europe PMC free article] [Abstract] [Google Scholar]
- Shan L, He M, Yu M, Qiu C, Lee N H, Liu E T, Snyderwine E G. cDNA microarray profiling of rat mammary gland carcinomas induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine and 7,12-dimethylbenz[α]anthracene. Carcinogenesis. 2002;23:1561–1568. [Abstract] [Google Scholar]
- Shan L, Yu M, Snyderwine E G. Gene expression profiling of chemically induced rat mammary gland cancer. Carcinogenesis. 2005;26:503–509. [Abstract] [Google Scholar]
- Shan L, Yu M, Snyderwine E G. Global gene expression profiling of chemically induced rat mammary gland carcinomas and adenomas. Toxicol Pathol. 2005;33:768–775. [Abstract] [Google Scholar]
- Papaconstantinou A D, Shanmugam I, Shan L, Schroeder I S, Qiu C, Yu M, Snyderwine E G. Gene expression profiling in the mammary gland of rats treated with 7,12-dimethylbenz[α]anthracene. Int J Cancer. 2006;118:17–24. [Abstract] [Google Scholar]
- Medina D, Kittrell F. Stroma is not a major target in DMBA-mediated tumorigenesis of mouse mammary preneoplasia. J Cell Sci. 2005;118:123–127. [Abstract] [Google Scholar]
- Maffini M V, Soto A M, Calabro J M, Ucci A A, Sonnenschein C. The stroma as a crucial target in rat mammary gland carcinogenesis. J Cell Sci. 2004;117:1495–1502. [Abstract] [Google Scholar]
- Orimo A, Weinberg R A. Stromal fibroblasts in cancer: a novel tumor-promoting cell type. Cell Cycle. 2006;5:1597–1601. [Abstract] [Google Scholar]
- Macinnes A W, Amsterdam A, Whittaker C A, Hopkins N, Lees J A. Loss of p53 synthesis in zebrafish tumors with ribosomal protein gene mutations. Proc Natl Acad Sci U S A. 2008;105:10408–10413. [Europe PMC free article] [Abstract] [Google Scholar]
- Van Agthoven T, van Agthoven T L, Dekker A, van der Spek P J, Vreede L, Dorssers L C. Identification of BCAR3 by a random search for genes involved in antiestrogen resistance of human breast cancer cells. EMBO J. 1998;17:2799–2808. [Europe PMC free article] [Abstract] [Google Scholar]
- Oshiro M M, Futscher B W, Lisberg A, Wozniak R J, Klimecki W T, Domann F E, Cress A E. Epigenetic regulation of the cell type-specific gene 14–3σ-3sigma. Neoplasia. 2005;7:799–808. [Europe PMC free article] [Abstract] [Google Scholar]
- Wolff G L, Kodell R L, Moore S R, Cooney C A. Maternal epigenetics and methyl supplements affect agouti gene expression in Avy/a mice. FASEB J. 1998;12:949–957. [Abstract] [Google Scholar]
- Waterland R A, Dolinoy D C, Lin J R, Smith C A, Shi X, Tahiliani K G. Maternal methyl supplements increase offspring DNA methylation at Axin fused. Genesis. 2006;44:401–406. [Abstract] [Google Scholar]
- Resseguie M, Song J, Niculescu M D, da Costa K A, Randall T A, Zeisel S H. Phosphatidylethanolamine N-methyltransferase (PEMT) gene expression is induced by estrogen in human and mouse primary hepatocytes. FASEB J. 2007;21:2622–2632. [Europe PMC free article] [Abstract] [Google Scholar]
Articles from The FASEB Journal are provided here courtesy of The Federation of American Societies for Experimental Biology
Full text links
Read article at publisher's site: https://doi.org/10.1096/fj.08-122168
Read article for free, from open access legal sources, via Unpaywall:
https://europepmc.org/articles/pmc2660648
Free after 12 months at www.fasebj.org
http://www.fasebj.org/cgi/content/full/23/4/1054
Free to read at www.fasebj.org
http://www.fasebj.org/cgi/content/abstract/23/4/1054
Citations & impact
Impact metrics
Citations of article over time
Smart citations by scite.ai
Explore citation contexts and check if this article has been
supported or disputed.
https://scite.ai/reports/10.1096/fj.08-122168
Article citations
Maternal Choline Supplementation as a Potential Therapy for Down Syndrome: Assessment of Effects Throughout the Lifespan.
Front Aging Neurosci, 13:723046, 06 Oct 2021
Cited by: 6 articles | PMID: 34690739 | PMCID: PMC8527982
Choline: Exploring the Growing Science on Its Benefits for Moms and Babies.
Nutrients, 11(8):E1823, 07 Aug 2019
Cited by: 52 articles | PMID: 31394787 | PMCID: PMC6722688
Maternal choline supplementation during the third trimester of pregnancy improves infant information processing speed: a randomized, double-blind, controlled feeding study.
FASEB J, 32(4):2172-2180, 05 Jan 2018
Cited by: 79 articles | PMID: 29217669 | PMCID: PMC6988845
The Impact of Traditional Food and Lifestyle Behavior on Epigenetic Burden of Chronic Disease.
Glob Chall, 1(8):1700043, 27 Oct 2017
Cited by: 5 articles | PMID: 31565292 | PMCID: PMC6607231
Review
Free full text in Europe PMCA pilot study of the effect of human breast milk on urinary metabolome analysis in infants.
J Pediatr Endocrinol Metab, 30(9):939-946, 01 Aug 2017
Cited by: 7 articles | PMID: 28777736
Go to all (29) article citations
Data
Data behind the article
This data has been text mined from the article, or deposited into data resources.
BioStudies: supplemental material and supporting data
SNPs (2)
- (1 citation) dbSNP - rs12325817
- (1 citation) dbSNP - rs7946
Similar Articles
To arrive at the top five similar articles we use a word-weighted algorithm to compare words from the Title and Abstract of each citation.
Effect of maternal and postweaning folic acid supplementation on mammary tumor risk in the offspring.
Cancer Res, 71(3):988-997, 06 Dec 2010
Cited by: 67 articles | PMID: 21135116
Early-in-life dietary zinc deficiency and supplementation and mammary tumor development in adulthood female rats.
J Nutr Biochem, 44:71-79, 01 Apr 2017
Cited by: 0 articles | PMID: 28427009
Tumor Phenotype and Gene Expression During Early Mammary Tumor Development in Offspring Exposed to Alcohol In Utero.
Alcohol Clin Exp Res, 40(8):1679-1690, 04 Jul 2016
Cited by: 1 article | PMID: 27373230 | PMCID: PMC4961575
Atlas and histologic classification of tumors of the rat mammary gland.
J Mammary Gland Biol Neoplasia, 5(2):187-200, 01 Apr 2000
Cited by: 130 articles | PMID: 11149572
Review
Choline nutrition programs brain development via DNA and histone methylation.
Cent Nerv Syst Agents Med Chem, 12(2):82-94, 01 Jun 2012
Cited by: 46 articles | PMID: 22483275 | PMCID: PMC5612430
Review Free full text in Europe PMC
Funding
Funders who supported this work.
NCI NIH HHS (2)
Grant ID: R21 CA120488
Grant ID: CA120488
NIA NIH HHS (2)
Grant ID: AG009525
Grant ID: P01 AG009525