Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Letter
  • Published:

Mobilization of transposons by a mutation abolishing full DNA methylation in Arabidopsis

Nature volume 411, pages 212–214 (2001)Cite this article

Abstract

A major component of the large genomes of higher plants and vertebrates comprises transposable elements and their derivatives, which potentially reduce the stability of the genome1. It has been proposed that methylation of cytosine residues may suppress transposition, but experimental evidence for this has been limited2,3,4,5. Reduced methylation of repeat sequences results from mutations in the Arabidopsis gene DDM1 (decrease in DNA methylation)6, which encodes a protein similar to the chromatin-remodelling factor SWI2/SNF2 (ref. 7). In the ddm1-induced hypomethylation background, silent repeat sequences are often reactivated transcriptionally, but no transposition of endogenous elements has been observed8,9,10,11. A striking feature of the ddm1 mutation is that it induces developmental abnormalities by causing heritable changes in other loci12,13. Here we report that one of the ddm1-induced abnormalities is caused by insertion of CAC1, an endogenous CACTA family transposon. This class of Arabidopsis elements transposes and increases in copy number at high frequencies specifically in the ddm1 hypomethylation background. Thus the DDM1 gene not only epigenetically ensures proper gene expression13,14,15,16, but also stabilizes transposon behaviour, possibly through chromatin remodelling or DNA methylation.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Stable and unstable clm phenotypes.
Figure 2: Transposition of CAC1 element from the original donor site to the DWF4 locus.
Figure 3: Transposition of CAC elements in the ddm1 mutant background.
Figure 4: Transposition of CAC1 and CAC2 elements to unlinked loci.
Figure 5: The ddm1-specific hypomethylation and RNA accumulation of CAC elements.

Similar content being viewed by others

Accession codes

Accessions

GenBank/EMBL/DDBJ

Data deposits

The CAC1, CAC2, CAC3 and CAC4 sequences are deposited in GenBank under accession numbers AB052792, AB052793, AB052794 and AB052795, respectively.

References

  1. SanMiguel, P. et al. Nested retrotransposon in the intergenic region of maize genome. Science 274, 765– 768 (1996).

    Article  ADS  CAS  Google Scholar 

  2. Yoder, J. A., Walsh, C. P. & Bestor, T. H. Cytosine methylation and the ecology of intragenomic parasites. Trends Genet. 13, 335– 340 (1997).

    Article  CAS  Google Scholar 

  3. Martienssen, R. Transposons, DNA methylation and gene control. Trends Genet. 14, 263– 264 (1998).

    Article  CAS  Google Scholar 

  4. Walsh, C. P., Chaillet, J. R. & Bestor, T. H. Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nature Genet. 20, 116– 117 (1998).

    Article  CAS  Google Scholar 

  5. Matzke, M. A., Mette, M. F., Aufsatz, W., Jakowitsch, J. & Matzke, A. J. Host defenses to parasitic sequences and the evolution of epigenetic control mechanisms. Genetica 107, 271– 287 (1999).

    Article  CAS  Google Scholar 

  6. Vongs, A., Kakutani, T., Martienssen, R. A. & Richards, E. J. Arabidopsis thaliana DNA methylation mutants. Science 260, 1926– 1928 (1993).

    Article  ADS  CAS  Google Scholar 

  7. Jeddeloh, J. A., Stokes, T. L. & Richards, E. J. Maintenance of genomic methylation requires a SWI2/SNF2-like protein. Nature Genet. 22, 94– 97 (1999).

    Article  CAS  Google Scholar 

  8. Mittelsten-Scheid, O., Afsar, K. & Paszkowski, J. Release of epigenetic gene silencing by trans-acting mutations in Arabidopsis. Proc. Natl Acad. Sci. USA 95, 632– 637 (1998).

    Article  ADS  CAS  Google Scholar 

  9. Jeddeloh, J. A., Bender, J. & Richards, E. J. The DNA methylation locus DDM1 is required for maintenance of gene silencing in Arabidopsis. Genes Dev. 12, 1714– 1725 (1998).

    Article  CAS  Google Scholar 

  10. Steimer, A. et al. Endogenous targets of transcriptional gene silencing in Arabidopsis. Plant Cell 12, 1165– 1178 (2000).

    Article  CAS  Google Scholar 

  11. Hirochika, H., Okamoto, H. & Kakutani, T. Silencing of retrotransposons in Arabidopsis and reactivation by the ddm1 mutation. Plant Cell 12, 357– 369 (2000).

    Article  CAS  Google Scholar 

  12. Kakutani, T., Jeddeloh, J., Flowers, S., Munakata, K. & Richards, E. Developmental abnormalities and epimutations associated with DNA hypomethylation mutations. Proc. Natl Acad. Sci. USA 93, 12406– 12411 (1996).

    Article  ADS  CAS  Google Scholar 

  13. Kakutani, T. Genetic characterization of late-flowering traits induced by DNA hypomethylation mutation in Arabidopsis thaliana. Plant J. 12, 1447– 1451 (1997).

    Article  CAS  Google Scholar 

  14. Soppe, W. et al. The gain of function epi-mutant FWA causes late flowering. Mol. Cell 6, 791– 802 (2000).

    Article  CAS  Google Scholar 

  15. Jacobsen, S., Sakai, H., Finnegan, E., Cao, X. & Meyerowitz, E. Ectopic hypermethylation of flower-specific genes in Arabidopsis. Curr. Biol. 10, 179– 186 (2000).

    Article  CAS  Google Scholar 

  16. Kakutani, T., Munakata K., Richards E. & Hirochika, H. Meiotically and mitotically stable inheritance of DNA hypomethylation induced by ddm1 mutation of Arabidopsis thaliana. Genetics 151, 831– 838 (1999).

    CAS  PubMed  PubMed Central  Google Scholar 

  17. Choe, S. et al. The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22alpha-hydroxylation steps in brassinosteroid biosynthesis. Plant Cell 10, 231– 243 (1998).

    CAS  PubMed  PubMed Central  Google Scholar 

  18. Siebert, P. D., Chenchik, A., Kellogg, D. E., Lukyanov, K. A. & Lukyanov, S. A. An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res. 23, 1087– 1088 (1995).

    Article  CAS  Google Scholar 

  19. Nacken, W. K., Piotrowiak, R., Saedler, H. & Sommer, H. The transposable element Tam1 from Antirrhinum majus shows structural homology to the maize transposon En/Spm and has no sequence specificity of insertion. Mol. Gen. Genet. 228, 201– 208 (1991).

    Article  CAS  Google Scholar 

  20. Chandler, V. L. & Walbot, V. DNA modification of a maize transposable element correlates with loss of activity. Proc. Natl Acad. Sci. USA 83, 1767– 1771 (1986).

    Article  ADS  CAS  Google Scholar 

  21. Fedoroff, N. in Epigenetic Mechanisms of Gene Regulation (eds Riggs, A., Martienssen, R. & Russo, V.) 575– 592 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1996).

    Google Scholar 

  22. Scortecci, K. C., Dessaux, Y., Petit, A. & Van Sluys, M. A. Somatic excision of the Ac transposable element in transgenic Arabidopsis thaliana after 5-azacytidine treatment. Plant Cell Physiol. 38, 336– 343 (1997)

    Article  CAS  Google Scholar 

  23. Lawson, E. J., Scofield, S. R., Sjodin, C., Jones, J. D. & Dean, C. Modification of the 5′ untranslated leader region of the maize Activator element leads to increased activity in Arabidopsis. Mol. Gen. Genet. 245, 608– 615 (1994).

    Article  CAS  Google Scholar 

  24. McClintock, B. Chromosome organization and genic expression. Cold Spring Harbor Symp. Quant. Biol. 16, 13– 47 (1951).

    Article  CAS  Google Scholar 

  25. McClintock, B. The suppressor-mutator system of control of gene action in maize. Carnegie Institution of Washington Year Book 57, 415– 429 (1958).

    Google Scholar 

  26. Finnegan, E., Peacock, J. & Dennis, E. Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proc. Natl Acad. Sci. USA 93, 8449– 8454 (1996).

    Article  ADS  CAS  Google Scholar 

  27. Ronemus, M., Galbiati, C., Ticknor, J., Chen, J. & Dellaporta, S. Demethylation-induced developmental pleiotropy in Arabidopsis. Science 273, 654– 657 (1996).

    Article  ADS  CAS  Google Scholar 

  28. Furner, I. J., Sheikh, M. A. & Collett, C. E. Gene silencing and homology-dependent gene silencing in Arabidopsis. Genetic modifiers and DNA methylation. Genetics 149, 651– 662 (1998).

    CAS  PubMed  PubMed Central  Google Scholar 

  29. Amedeo, P., Habu, Y., Afsar, K., Scheid, O. M. & Paszkowski, J. Disruption of the plant gene MOM releases transcriptional silencing of methylated genes. Nature 405, 203– 206 (2000).

    Article  ADS  CAS  Google Scholar 

  30. Mourrain, P. et al. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101, 533– 542 (2000).

    Article  CAS  Google Scholar 

  31. Dalmay, T,, Hamilton, A., Rudd, S., Angell, S. & Baulcombe, D. C. An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101, 543– 553 (2000).

    Article  CAS  Google Scholar 

  32. Fagard, M. et al. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals. Proc. Natl Acad. Sci. USA 97, 11650– 11654 (2000).

    Article  ADS  CAS  Google Scholar 

  33. Singer, T., Yordan, C. & Martienssen, R. A. Robertson's Mutator transposons in A. thaliana are regulated by the chromatin-remodeling gene Decrease in DNA methylation (DDM1). Genes Dev. 15, 591– 602 (2001).

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank K. Munakata for technical assistance, A. Miyao for advice on the suppression PCR technique, and R. Martienssen and Y. Hiromi for comments on the manuscript. We acknowledge ABRC at the Ohio State University for the BAC clones.

Author information

Author notes

  1. Asuka Miura, Shoji Yonebayashi and Hiroaki Shimada: These authors contributed equally to this work.

Authors and Affiliations

  1. National Institute of Genetics, Mishima, 411-8540, Shizuoka, Japan

    Asuka Miura & Tetsuji Kakutani

  2. National Institute of Agrobiological Resources, Tsukuba, 305-8602, Ibaraki, Japan

    Shoji Yonebayashi & Tetsuji Kakutani

  3. CREST, Japan Science and Technology Corporation, Tokyo, 101-0062, Japan

    Koichi Watanabe, Tomoko Toyama & Tetsuji Kakutani

  4. Science University of Tokyo, Noda, 278-8510, Chiba, Japan

    Hiroaki Shimada

Authors
  1. Asuka Miura
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Shoji Yonebayashi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Koichi Watanabe
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Tomoko Toyama
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Hiroaki Shimada
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Tetsuji Kakutani
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Tetsuji Kakutani.

Supplementary information

Contact Tetsuji Kakutani (tkakutan@lab.nig.ac.jp) for further questions.

Genetic and molecular characterization of clm alleles.

Figure A.

(JPG 24.8 KB)

a, Fine mapping of the CLM locus. Recombination events were scored between the clam trait and genetic markers by examining progeny from self-pollination of heterozygotes with the wild-type CLM allele in Landsberg ecotype and the stable clm allele in Columbia ecotype backgrounds. Moo5sfi, r30025, T3A5L and T3A5R are PCR-based DNA markers polymorphic between the two ecotypes (the marker information is shown below).

Number of recombination events in the examined 926 chromosomes are shown between the markers and CLM locus. Polymorphism in the DWF4 gene completely co-segregated with the clm trait. b, Characterization of stable and unstable clm alleles.

Structure of the DWF4 gene in stable and unstable clm alleles. Thick and thin lines indicate the exons and introns of DWF4 gene, respectively. The stable clm allele has four base pair insertion; and the unstable clm allele has the three base pair target site duplication plus several kilobases of insertion, each end of which is identical to the sequence in chromosome 2.

Allelism test of clm and dwf4-4.

Figure B.

(JPG 14.6 KB)

a, A wild type Columbia plant; b, A clm homozygote; c, A progeny with the dwarf phenotype from a cross between dwf4-4/dwf4-4 and CLM/clm (stable allele) plants. Progeny from this cross segregated seven plants with clm phenotype and six normal plants, indicating that clm and dwf4-4 are allelic. black bar: 3mm.

Somatic reversion of DWF4 gene structure in the sector without the clm phenotype.

Figure C.

(JPG 26.0 KB)

(Top) Schematic drawing of experimental design. We used three primers simultaneously for PCR. From the DWF4 locus with or without CAC1 insertion, 293- or 245-bp DNA fragment is expected to be amplified, respectively (the primer sequences are shown in Methods section below). (Bottom) Genomic DNA was prepared from sectors with or without the clm phenotype in a chimeric plant. lane 1, Wild type Columbia ; lane 2, Sector with the clm phenotype; lane 3 and 4, Sector without the clm phenotype. DNA with the length expected for the CAC1 excision was specifically amplified from the sector without the clm phenotype. The reversion of the insertion site to wild type structure was confirmed by sequencing the bottom band of PCR product using 3R as the primer. The sizes of DNA length markers (lane 5) are 300 and 200 bp. In some chimeric plants, the excision of transposon was also observed in some of the sectors with clm phenotype. In these cases, however, the excision was imprecise and frame-shift mutation was always observed there. On the other hand, the normal sectors from the same plants show the precise reversion resulting in restoration of normal structure in one of two alleles. The structure of insertion site was examined by sequencing PCR product (data not shown).

CAC elements remain hypomethylated even after the copy number increase.

Figure D.

(JPG 26.0 KB)

(Top panel) Transposition and copy number increase in CAC elements. Probe A in Figure 3a was used (this panel is a reproduction of Figure 3c). (Bottom panel) Methylation status of CAC elements shown in the top panel. CAC elements remain hypomethylated even after the copy number increase during repeated self-pollination. The copy number and methylation status does not correlate among the different ddm1 lines. Genomic DNA from the same plant shown in top panel or their direct siblings were used. Probe C in Figure 3a was used to detect the methylation of CAC elements. Sequences flanking the transposed CAC1 and CAC2 (Figure 4). (sequence just outside the 5' end of CAC1 or CAC2 sequence was shown for each insertion)

1C1

  1. 1C1

    AAACCATTTTGACCAAANGCCATTGACTTNGGAGATGTGGCTTTTGGNCAAACACTCAAAACTATACTTTNTCTCTTTCATATCAGCACAATGAATTCAAGCATT

    This sequence matches the sequence of BAC clone T14E10 (GenBank AL13656).

  2. 1C2

    GTATCACCTGATCAAATACATATGATGTTCGGAAATTTGCATTATCAAACGGTCAGACAAAGGCTATATACTAGAACTCGTATCCAATTAAACATCATAATTGGATAG

    This sequence matches the sequence of BAC clone MQP17 (GenBank AP000602).

  3. 1C3

    GNTGNNGATANTGAGTACGATTTTTCAAACTTTTNTAAGNCCAACACACTTGAATATAA

    This sequence matches the sequence of BAC clone F20H23 (GenBank AC009540).

  4. 1D1

    CTGACAGCNAAACTNCCTGAGGACTCANCCTATGGACTCTCGATAACGGATCCANGTGACANCGANTGNTGCTTTCAATCTNCATNANCAAAGCNNTTGCTTGTCNCTGCNCNTATTCTTNANCCATCCAACTCCTTCATCATACA

    This sequence matches the sequence of BAC clone T1J8 (GenBank AC006922).

  5. 1D2

    GTGTTTGCTTCGCTTGCCGGAGTTTCACAGTGGTGGTACAACCGCGGTGATTCCGATGCCGTCATTGTCATTGTTCTTGATGTCACCAACAGAGAAAACCAGCTTGACCAAGTCCCTAGGGTAATCATCAAATTCAAGAAAGTCCAAATTTGTACTGCATGCAAACTATATGACTACCACTCAGTGATTAAATTAGTGNTTCATATATATAACACATA

    This sequence matches the sequence of BAC clone F21M11 (GenBank AC003027).

  6. 1D3

    TATGATAGGAAACAAAATTCTACCACCGTGTTATGTTTTTACTAATTTTTTTTTGTAGTTCCTATTAATTTTGNCATTTGCAACTCANAATTTTTGTATTATAGTATAAGTATAATTTTTATGGATAGNGGCTTTTTTTGCATTGNGCGTATTCCTGTATTTAATTTTATGTGACTTGATTTCTTGATACCTGCCCGGGCGGCCGNTCGAGCCCTATTA

    This sequence matches the sequence of BAC clone F23K16 (GenBank AL078620).

  7. 1D4

    GTTGCAGCAGTAATGTTAACTATTTAGCTATGAATTTCAATTGTGTACTTAAAAGTAATGTTTTTGGTTTTCAAAGATTATAAAATTCGAAAATACTAATTGTGATTTGTGAGTTCCATTGATAAATAAGCAAACATAAAGGACCAACA

    This sequence matches the sequence of BAC clone F21B7 (GenBank AC002560).

  8. 1E1

    AAACAANNCCAAATGANTAANGGCCAGGCTTATCCCTGAACANNGCTTAGGG

    This sequence matches the sequence of BAC clone F19C24 (GenBank AC025294).

  9. 1E2

    GAGGGACCAGTCAATACTCACTTTTCCTTTCTTTTTTTCTCACTGTCTTTGCTTTCTGCTAATTATCTAACTTTTCCAACAGATTAGACGTAACTTTAACATAATTTAAACCTTAATTTATGGGTGATTAAGGTAGATATATGTAGTTTTTTAGTAATAACCTATGCTAGACTTCCAGGTACATGATTCTTCTCTATGCTTCATTTATAAGTTTTCTTTCCTTTTCAGTTTTTACTTACATAACAAAATTCAATTAAGTTTTTTT

    This sequence matches the sequence of Contig No.36 of chromosome 4 (GenBank AL161536).

  10. 1F1

    TGAGTAACTTATCATTGATCTGAACTGATGAATAGATAGATTACAAAAAAAGTGTGTATAATTTTCAAACTGGCAAAAATCATCCCACCATTATGCTAGCCACCAATGAGATTCTAAGTTAGATTTTGTTACTTACATTGTAACAGCGGAACATAATCTGTAGTAGAAAAAACTAGAAAAGCTTTATTAAATTGAAAAATCATCTTAATGACGGTTAACTTTCCGAAATGGTGAAACCATTCCACCATTATGCATGAGAACTACCAATTAGACTCTAAGTTAGTTACGGCATTAATTATATTCTCATTCCACCATTATGCATGAGAACTACCAATTAGACTCTAAGTTAGTTCGACATTATATTAATTCTTGTTGACATGTNCTTGATTTTACTGTTACAGATCATCGAGTGTANGAGGGTCTTGAAATGGACCTATGCATATGGATACTACATACTTAGTCAAGAGCGC

    This sequence matches the sequence of BAC clone F20M17 (GenBank AC006533).

  11. 1G1

    TACTCTAACGTAAAGATCCTGACCTCCCTTAGCATAATTTCGGATACCTGCCCGGGCGGCCGCTCGAGCCCTATTAA

    This sequence matches the sequence of BAC clone F1E22 (GenBank AC007234).

  12. 1H1

    TCTGTTTAGATAAGGTGAATGGTGATACTGACACATACATATAAATATATAGTTTCAAAGGTGCATTCTTGTGTTGCTTTTTGAGCATTGTACGTCATACACTACCACAATGTCTGCTTTCAAATAGAATCACCAAAGAGCATANAGATACCTGCCCGGTCGGCCGCTCGAGCCCTATTTT

    This sequence matches the sequence of BAC clone F6A14 (GenBank AC011809).

  13. 1K1

    TACTCATATTTTGTGGAGATTTTAGTTTCTTCGAGATCGATCACTAACCTATCATCACATCTGTCCAATTAAAGAGGAGAAGAAACAAATCTTGGAGGCAAGTATAAAGAGCCTCACAAGCCAGAAAGTCACAACACTACAAGAAAAATCAAACCAAATTAAAAGTACTCATAGATACCTGCCCGGGCGGCCGCTCGAGCCCTATTA

    This sequence matches the sequence of BAC clone F16P19 (GenBank AC011000).

  14. 1K2

    ATGTTAGCGTTTGGTCGAGCCAGTGACTGAAGAACTACTTCTATCCCTTGGTTGCATCCGACAGTTATGAATACATCATTAGGCTTTACCTTGTTCGTCAAGTCTCGGTTCACGTAATCTGCGACCGCCCTGATTAACAAAACATTCCATGAAAATACTGTTAGGTTTTGAATGGTTACAGACTTACAGTGGGTGGAACAAAG

    This sequence matches the sequence of BAC clone F20O9 (GenBank AL021749).

  15. 1L1

    AGATCTGAGACGAGTTAGTGGCTCGTGACACCAAAGATTGCACGGCAGGAGAGATGGCTCCGATCAAAGCACTGAAGATCAACTTGTCTTGTCGTTTCCAGAGAGTAAACGACGGATTGGCAGAGACAACACTGTTGATGGTGGTTGTTTCTGGTGGGATGACAACAGAGTTATCAAGATAACCTGCTAGATCATAACCATCAAGCAAGGCATGGATCTGAATACTCCACATCAAATAGTTGGTCGATGTGAGCTTAGTGACATTCGACGTATTGACGTTAAAGAGTGTCTGAGGGGTGAGAACGATAGCTTCGTCTCTAGTGGCGGGGAGGCCGTTGACTTGAGACATGATTGGCGGCTAGGTTTTGAAAAGAAGAAAAAGAAAAGAAAAGTAGGTTTTAGGATACCTGCCCGGGCGGCCGNTCGAGCCCTATTA

    This sequence matches the sequence of RPP5 contig (GenBank AF180942).

  16. 1L2

    AGAGCACATAGGAATANAGATGCACGATAGACNTNTANCTNTTCTATCTTTCTNTCTTTTTTTATATCAACTTTGAGGNTAAAGTATNAAANACNATTANANACACNTATCTGTGNCTNTTTTGCATAGCATCCTTAGAGCTCTCTATCTTCTGTNAGCAACCACACTATCACCCTCCACTATACATACAGCATTCTTGCGGATTGATATATAAGATGTGAGGATAGAGACTATATATAGAGAGAGGCGG

    This sequence matches the sequence of BAC clone F11I4 (GenBank AC073555).

  17. 2G1

    TTCCTTTGTTTGAACTTCTAAATCCACACAAAAATACAAGAAAAGTCAAATAATGTGGTCTTTATCATATTTGTTTGCTCCGAAAATATAGTGTCACTTGAACAAAACTCTTGACAAACTGGCCTATACTGGTTTTTTTTCTTAACCAATTTATCCGTTAATTTTCAATGCCGTATTGGGTTCACTTCGAAGCATTTCCTGTCAGTCATTATAATCCACCAATAATGNCAGTTTCTCTCTCTCGCCCAAAAACCGAACGATCCGAGGTGAATATAAATGAAACATGTCATTAATTAATATATTTATATCAAAGTTTTTTCCGGCTTTTGAAGCTTGAAAATACTCCCATATATTTA

    This sequence matches the sequence of BAC clone T16I18 (GenBank AL049915).

  18. 2I1

    ATAACAAGAAAAAAAAAGGGCTTTNNNGGGGANANATCNCCTANCTTTNNTAAGTTTGGGNTTNGGNAAANAAANGTNTTCNCTANCCAANGCCTCNTCCCA

    This sequence matches the sequence of BAC clone F24B22 (GenBank AL132957).

  19. 2F1

    NCNCNTNCNAANNCTTANCCNCTNNNCCATTCCTCATCTTANGAAACAAAATCNACATACCTTACGCTGCATCTGAGGACGAGCTNNGNTTCCATNTTGGCCTCTCCAATCTCACANCTGGTNNAGGCNCAGNGAANCTAACNGANTCGCATG

    This sequence matches the sequence of BAC clone T14P4 (GenBank AC022521).

  20. 2F2

    ANCATTGACCANATNGNNTNTNNNTNATAACCANAANCGGNTTANAATNAACCATATATTNTTTTCCCTCTAATTCAAGAAATATGGCATAGNTTAATTCATTTGNATATGCTGCNGGATATTTTAAATACAATCCCTAGCTAGTTATATAATATAGATCTTAGAATGCAAACATATGCATTGGAGNGGACGGTACGAAGAATTGGANCTGAAGCT

    This sequence matches the sequence of BAC clone T9A21 (GenBank AL021713).

  21. 2M1

    ANAACNGACCATTGGNNGGNATGCAGTANNNGATNNANANATNTNANNNNTANCTNNNNNACACCCANCAAATNNACNNANTTNNNNNCGANTGCNCGAGAGAGNTACNNNCATGGNNCACCTNCCANAAANACNTNNANNCNNACANCNNNACANNTTTANGTAAATATCTATATAGACGAGAAAAAGGTGGAANACCGACTATNCTTTAGACACCGANGCCNAGCTCNGGCAACCGATACTTTCCTTNGAANGNCCAATNCNAGNTNNNCGAGAANNGAGGNNNNAGGANANNANCTCTTCTATNGAACTCCATANTATGTCCTAATGTTATCGCTTNATACTTGATACCTGCCCGGGCGGCCGCTNNAGCCCCNTTANGGNCATTGNTTTCGAATATTTTTCATGNATCAAAGCTCTTATAAACAAGATACCTGCCCGGNCGGCCGTTCGAGG

    This sequence matches the sequences of several BAC clones around centromere of chromosome III (not shown in Figure 4).

  22. 2M2

    TTAACTGAACATTTGCGGTTTTGCAGTATCAGATTAATAGTCTTTTTTCTTCTTTTTTTTACACATAATTCATTCATTGATTTTGAATCGAATACAAGAGTTAGATACATCCGTAATACATTATTAATAAACACATTCAAACATACATCCACACAATTATAATTAAATATTTTAATAAACGATAAAAAGGTGAATTTCGACTATGCTTTAGAAACCGAAGTCTTGCTCGTCAACCGTTTCTTTCCTTTTCAGATTCAATCCCAAATTGATGAGATCGTCGTTTTTGGTTATCATCTCTTCGATGAAACTCCATAATCGTCTAATGTTATTGATGTTACTTGATACCTGCCCGGGCGGCCGCTCGAGCCCCTTTA

    This sequence matches the sequence of fragment #1 of chromsome 4 (Z97336).

  23. 2M3

    AACGGTGAGTGATGATCTTAATTTGATGATGCATATATTGGTGTAACTTTAGTTTTCTTTAATATCAGTTTGTGATTGNGAAACGTTTTCAGGACAAGATAAAAGGATCTGACTCTGGTCACCCGAGTTTGGCTGATCTTCTTGGTCTTAACACTCTCAGCCCTAATAAACTCTCTGAAGAGATTCTGAGAAGTATTTGTGTGATACACTACAAACTCTCAGACAATGGACATAACAGATTGGTCAAGAACTCAAAGAATGAAGAGTATGGGCAGGAACTTGGAGTTGGTATCCATAAGCTATACCTAGACGATTACAATTTAAAGTCCGTAGAGAGCATGCTTCAGAATTTTAGGTGAGATTGCATTTTAAAGAAAAATG

    This sequence matches the sequence of BAC clone F2H10 (GenBank AC026757).

  24. 2K1

    AGTACAAGTTGCCAAAATAGATTGGCGTGATGCACGCTTGACACAGCCTATCCTCGTCGTATTCTCTACATGTATTCTCATCAAGTCGCAAGTGATGATACTGATGAATGAAATGTTGTATGATTCCATCACTTATCCTCACAAATGGCGGAATTTCTTCAATGTCTTCTTCTGGCTCTCCCTCAAGTTCTACACCATCCCACACATTGCTTTGTGTGGCACACCTTGAATGTGCCGCATACGAACAACCGTACTTAACGCAAGAATAACCCCCGAAATCATTTTCAATCTTTCTGCGACAAACACCACAAAACCAATTTCCTTGATGAAAAGAAGGGGTAAAA

    This sequence matches the sequence of BAC clone MSK20 (GenBank AP000650).

  25. 2K2

    AATTNATAATTGNAATGAGTCATTAGGTAGGATACGGGATACTTCCCTTCTTGAGCAATTAGAAGGAAGTCCTTCAACATACAGAGTGTTGGATACATCTGGAGGTAGAGGATGTGGTTCCCGGCCTGGCCTACCAACTGAATCCAGCTGACCAAAACCCATATCCCGACCATTTGGCCTGAAATCTGAAGGCAAACTCCCACCACACCCAGCCATGAGCTCACCCATGGNCGGACCAGGCATCATGTTGGAACCTCCTTGTCGTACCATGCCAACACCATTAAATGGACCAGCTTCTTCAGATGGCACAAAAAACGTT

    This sequence matches the sequence of BAC clone F16F4 (GenBank AC036104).

  26. 2K3

    ACAATAATTTGTTGACAAAATCAAATACCAATAATTTTGATTAATGTTAGTAGTATAACTTATAAGTAATAACGTGTTTTGTCTAATGAAGCAAGTATTAAACTAATCTTAATTTGATATGTTTCTTGCTGGGATGCAAACCAAATTAAAACATTTAATTTGTTTCTTCTCAGAAGAGCAAACGTGGANTCATAAACACCCACATGATCTAGTTAACGTTTTCTTTAAAACGCA

    This sequence matches the sequence of BAC clone T11I18 (GenBank AC011698).

  27. 2K4

    NAAGCTGAATCTTGGTCAACTAGGCCTGAGAGGGAGATGGACTAGGACAGGCGGNCCAGGCGGNTCAGTCAACAAGTCCTAGCTCGTGATAGAAGAAGAGCTT

    This sequence matches the sequence of BAC clone T32B3 (GenBank AC024226).

  28. 2L1

    AAAACTAACTAGTTTACCTAAACAAAAGTATTCTATATAACAATGAAAAATCTCTCAATCTTTCTATTTCTTTTTGGGCTTTGCATATTGGTGATGTATACATGAAAAAATCTATGTTTACGGTCATGACCGAATTCAGTCG

    This sequence matches the sequence of BAC clone MDJ14 (GenBank AB016889).

Methods

1. Mapping CLM locus

Primer set and restriction enzyme to detect polymorphism (Figure A)

Moo5-Sfi: 5'-GTGATCTTTACTTCACTAATG-3', 5'-TTTATCCTTCCCTCTCCTAG-3', Hind III

r30025: 5'-TTGGATGAGATTGCAAGCCTTCA-3',5'-GGTCAAAGCAACATTACATTGTA-3', Hind III

T3A5L: 5'-GAACAAGACGGCTAAAAACG-3', 5'-AGATCATCGGTCTAGCGGTT-3', (cut unnecessary)

T3A5R: 5'-TAGAAGGTGACACAG-3', 5'-CAAGATGTATCGGCAC-3', Tsp5091.

The T3A5L and T3A5R markers were designed after sequencing Landsberg and Columbia genome. Information for markers Moo5Sfi and r30025 is kindly provided by Shauna Somerville lab.

2. Sequencing the DWF4 gene

The following primer sets were used for the amplification and sequencing of DWF4 gene in stable clm homozygote.

clm1F: 5'-GTCCACTTTCGAAAGTCGAA-3' and clm1R: 5'-TAAGAGAGAGAAAGAGACGT-3'

clm2F: 5'-GTATCAAAGCCGTGACTAAT-3' and clm2R: 5'-GCCCTAAAGCCGTTGAAGAG-3'

clm3F: 5'-TCGCGATCTCAAGATGCTCT-3' and clm3R: 5'-TACAAAACGAAGGAAGGCTC-3'

clm4F: 5'-GACCATTTCCCAAGAATCCC-3' and clm4R: 5'-TATACGCGCTCAAAGTATGT-3'

3. Suppression PCR

The condition for suppression PCR was described in Siebert et al., (1995) Nucleic Acids Research 23, 1087-1088. Adapters were ligated to EcoRV-digested genomic DNA.

To amplify genomic DNA flanking the insertion of DWF4 from 5' of DWF4, Primers 5'-CGATCGTATCAGCTGATGCTGGACTTA-3', 5'-TACAAAACGAAGGAAGGCTC-3', and 5'-AGGTGGGATTCTTGGGAAATG-3' were used for the first and second PCR, and sequencing, respectively.

To amplify genomic DNA flanking the insertion of DWF4 from 3' of DWF4, Primers 5'-GTTTCTTCTTCTCCAGGATCCATACTC-3', 5'-GCTTCGCCATTAGATTAAACG-3', and 5'-TTTGGCCTCGTCTTGAGCAGA-3' were used for the first and second PCR, and sequencing, respectively.

To amplify genomic DNA flanking CAC1 5' region, primers 5'-CAGCGACAGATCTTAGCTTTTAGGTTG-3' and 5'-GGATTCGACAGATCTAAGGCA-3' were used for the first and second PCR, respectively. Primer 5'-AGTGTTGGCGCTGAAGTGAAT-3' or 5'-CATCTTTTATAGCAGTTGAGG-3' was used for the sequencing.

To amplify genomic DNA flanking CAC2 5' region, primers 5'-GCCAGCGACAATGTTGAATCG-3' and 5'-TTCGACAGATCTTAGCTTTTA-3' were used for the first and second PCR, respectively. Primer 5'-AGTGTTGGCGCTGAAGTGAAT-3' was used for the sequencing. Although this combination of the primer sequences is also expected to amplify sequences flanking CAC3, we could obtain only the donor copy of CAC3 in both the wild type and selfed ddm1 plants.

4. Sequences of primers used in the experiment shown in Figure 2

  • D1: 5'-TTAAAACATGGGTTTGGATTC-3'

  • D2: 5'-CCTTATTACCTTACAACTTTA-3'

  • A1: 5'-ATGCTCTTCCTTCAAAAGTAT-3'

  • A2: 5'-CAGAGACAATTGATTATAGAT-3'

  • F1: 5'-ACTGATAGTGACGATGAATCT-3'

  • R1: 5'-TCAGATCTAGCATATTCAGCT-3'

5. Sequences of primers used to show somatic reversion of DWF4 gene structure in the sector without clm phenotype (Figure C)

  • 3R: 5'-TACAAAACGAAGGAAGGCTC-3'

  • S6: 5'-TTTGGCCTCGTCTTGAGCAGA-3'

  • R5: 5'-AGTGTTGGCGCTGAAGTGAAT-3'

6. Probes used for experiments in Figure 3 and 5.

The probes A, C, D were amplified from the BAC clone T10J7 using the primer pairs shown below.

The probe B was prepared after HindIII digestion of the probe A and purfication of the 1.4 kb fragment.

Probe A: R1 (see above) and D5p: 5'-GATGTTAGAGGAAGCATTGGA-3'

probe C: F100: 5'-TATTGTCGATTGTGTTTGCCA-3' and R100: 5'-AGCCTCTCTTCCCAAATGTAC-3'

probe D: F102: 5'-AAAACTAGCGCAGCCTTTAAG-3'

and R102: 5'-CTTTCCGGTAATATCCATCAA-3'

Rights and permissions

Reprints and permissions

About this article

Cite this article

Miura, A., Yonebayashi, S., Watanabe, K. et al. Mobilization of transposons by a mutation abolishing full DNA methylation in Arabidopsis. Nature 411, 212–214 (2001). https://doi.org/10.1038/35075612

Download citation

  • Received:

  • Accepted:

  • Issue Date:

  • DOI: https://doi.org/10.1038/35075612

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing