An off–on–off electrochemiluminescence approach for ultrasensitive detection of thrombin

doi:10.1016/j.bios.2014.03.012

Biosensors and Bioelectronics

Volume 59, 15 September 2014, Pages 58-63

https://doi.org/10.1016/j.bios.2014.03.012 Get rights and content

Highlights

•
An “off–on–off” ECL–RET approach for thrombin detection was provided.
•
CdS:Eu nanocrystals (NCs) film was applied as ECL emitter.
•
Au NPs labeled thrombin binding aptamer (TBA) was linked with CdS:Eu NCs.
•
ECL signal could be controlled by thrombin-TBA recognition or DNA hybridization.
•
The approach could detect thrombin in a wide range from 50 aM to 1 pM.

Abstract

This work demonstrates an aptasensor for ultrasensitive electrochemiluminescence (ECL) detection of thrombin based on an “off–on–off” approach. The system is composed of an Eu³⁺-doped CdS nanocrystals (CdS:Eu NCs) film on glassy carbon electrode (GCE) as ECL emitter. Then gold nanoparticles (AuNPs) labeled hairpin-DNA probe (ssDNA1) containing thrombin-binding aptamer (TBA) sequence was linked on the NCs film, which led to ECL quenching (off) as a result of Förster-resonance energy transfer (FRET) between the CdS:Eu NC film and the proximal AuNPs. Upon the occurrence of hybridization with its complementary DNA (ssDNA2), an ECL enhancement (on) occurred owing to the interactions of the excited CdS:Eu NCs with ECL-induced surface plasmon resonance (SPR) in AuNPs at large separation. Thrombin could induce ssDNA1 forming a G-quadruplex and cause the AuNPs to be close to CdS:Eu NCs film again, which resulted in an enhanced ECL quenching (off). This “off–on–off” system showed a maximum 7.4-fold change of ECL intensity due to the configuration transformation of ssDNA1 and provides great sensitivity for detection of thrombin in a wide detection range from 50 aM to 1 pM.

Introduction

Thrombin is a physiological serine protease involved in coagulation-related reactions responsible for blood clotting (Dihanich et al., 1991, Yang et al., 2011). Changes in thrombin concentration levels in the blood are known to be associated with various coagulation abnormalities and it is considered as a biomarker for tumor diagnosis (Hwang et al., 2001, Liu et al., 2009). Thus, highly sensitive detection of thrombin is of immense importance for early diagnosis, clinical practice and following disease recurrence (Centi et al., 2007, Forrest, 1997). Thrombin binding aptamer (TBA), owing to lots of advantages as the ease of labeling, excellent stability and high affinity and selectivity towards thrombin (Iliuk et al., 2011, Osborne and Ellington, 1997), has been widely used as recognition element to construct thrombin biosensor combined with different analysis methods, such as colorimetry, fluorescence, surface plasmon resonance (SPR), electrochemistry, electrochemiluminescence (ECL), and so on (Huang et al., 2013, Li et al., 2012b, Shan et al., 2011, Tang et al., 2007, Wu et al., 2013, Xiao et al., 2005, Xue et al., 2012). Among them, ECL techniques, the generation of an optical signal triggered by electrochemical reactions, have appeared to be an excellent alternative to other methods due to the combination of advantages of both electrochemical and chemiluminescent biosensors, such as high sensitivity and ease of control (Richter, 2004).

TBA is known to form a stable G-quadruplex (G4) structure binding to thrombin, which adopts a specific three-dimensional (3-D) “chair structure” (Liao et al., 2011, Niu et al., 2012). The conformational changes induced by thrombin–TBA recognition events make distance-related resonance energy transfer (RET) techniques an ideal means for thrombin detection (Babu et al., 2013, Boeneman et al., 2009, Krauss et al., 2012). Recently, increasing interest has been attracted to the cooperation of RET with ECL techniques (named ECL–RET) which could fabricate sensitive ECL switches to obtain amplified signals transition, due to its high sensitivity, rapid biological response, as well as good controlment (Li et al., 2012a, Shan et al., 2009, Sun et al., 2012, Wang et al., 2013, Wu et al., 2012). To obtain optimal ECL–RET efficiency, perfect energy overlapped donor/acceptor pair is of great importance, therefore energy tunable materials are especially appealing as potential donor and acceptor (Wang et al., 2011, Zhou et al., 2012). As we know noble metals could not only be used as electrode materials but also as SPR substrates. Simultaneous application of SPR, electrochemical and ECL techniques on the same Au substrate was reported (Ramanaviciene et al., 2012). Recently, considerable efforts have been made to ECL–RET phenomena between semiconductor nanocrystals (NCs) and plasmons in metallic nanoparticles (NPs) (He et al., 2013, Zhang et al., 2012). As one of the most popular ECL emitters, CdS NCs become a candidate donor for their quantum effect and surface-sensitive ECL intensity, while gold nanoparticles (AuNPs) emerge as the widely applied acceptors because of their high extinction coefficients and strong size-dependent SPR properties (Wang et al., 2011, Khlebtsov, 2008). Similar to photoluminescence (PL), the RET between CdS NCs and the ECL-excited SPR in AuNPs could result in distance-dependent ECL quenching or enhancing (He et al., 2013, Shan et al., 2009).

In the classic RET case, the donor must have a wide range of emission tunability for the better controlment of the spectral overlap with the absorption spectra of a particular acceptor and higher excited-state lifetime than the acceptor (Sarkar et al., 2013). Eu³⁺-doped CdS nanocrystals (CdS:Eu NCs), the donor used in this ECL–RET system, possess improved ECL intensity and efficiency with two ECL emission bands at 450–550 nm from the host CdS and 600–650 nm due to the energy transfer from host CdS to Eu³⁺ ions (Deng et al., 2012, Zhou et al., 2012). The doped Eu³⁺ ions also affect the electric field of CdS:Eu NCs surface, which can further influence the SPR in AuNPs (the accepter). The conformational changes of TBA alter the distance between the donor and the acceptor thus modulating the signal to detect ultra-low concentration of thrombin.

In this work we applied CdS:Eu NCs as the ECL emitters and AuNPs functioning as both ECL quencher and enhancer together with TBA to control the distance to form a novel “off–on–off” ECL biosensor. Since TBA can specifically bind with thrombin much stronger than its complementary DNA chain, ultrasensitive detection of thrombin was achieved. The presence of thrombin was perceived by the decrease of ECL intensity originating from the distance variation between AuNPs and CdS:Eu NCs by complementary DNA and thrombin. The difference between ECL intensity before and after incubating with target protein (ΔI), was correlated to the concentrations of thrombin. This ECL aptasensor showed a high specificity and a wide linear range.

Section snippets

Reagents

The purified thrombin (the activity of enzyme was 10 U mg⁻¹, freeze-dry powder) and labeled DNA oligonucleotides were purchased from Shenggong Bioengineering Ltd. Company (Shanghai, China). These oligonucleotides employed had the following sequences:

36-Mer thiol molecular beacon (MB, 26-base loop and 5-bp stem) ssDNA1 (TBA): 5′NH₂(CH₂)₆CTCTCAGTCCGTGGTAGGGCAGGTTGGGGTGACTGT(CH₂)₆SH3′

22-Mer ssDNA2: 5′ACCCCAACCTGCCCTACCACGG3′

5′-thiol modified noncomplementary ssDNA3 (dilution DNA): 5′SH(CH₂)₆CTTGAAT3׳

Mechanism of the “off–on–off” ECL aptasensor

The principle of TBA-based assay for thrombin using AuNPs as both ECL quencher and enhancer is shown in Scheme 1. CdS:Eu NCs used as ECL emitter were first coated on GCE surface. Our previous work has demonstrated that the CdS:Eu NCs at 1.5% doping level showed 4-folds stronger and more stable cathodic ECL signals compared to pure CdS NCs, for Eu³⁺ ions could alter the surface of CdS NCs and create a new surface state-Eu³⁺ complex to facilitate effective energy transfer from host to Eu³⁺ ions (

Conclusions

This work demonstrated an ultrasensitive “off–on–off” aptasensor based on distance-controlled ECL–RET between CdS:Eu NCs and AuNPs. Thus, thrombin-induced configuration transformation of single TBA induced a total 7.4-fold variation of ECL signals. This signal variation may be further amplified by using other energy matching non-magnetic ECL emitters instead of the diluted magnetic semiconductor. Such great amplification together with the specificity of the TBA made a concentration detection

Acknowledgments

This work was supported by the 973 Program (2012CB932600) and the National Natural Science Foundation of China (Grant no. 21135003, 21025522, 21105019), the National Natural Science Funds for Creative Research Groups (Grant no. 21121091) of China.

References (42)

M. Dihanich et al.
Neuron
(1991)
L.Y. Fang et al.
Anal. Chim. Acta
(2008)
M.Y Li et al.
Electrochim. Acta
(2012)
Y.F. Li et al.
Electrochim. Acta
(2012)
Y.H. Liao et al.
Sens. Actuators B-Chem.
(2011)
S.Y. Niu et al.
Anal. BioChem.
(2012)
A. Ramanaviciene et al.
Biosens. Bioelectron.
(2012)
L.Y. Sun et al.
Electrochem. Commun.
(2012)
Q.J. Tang et al.
J. Colloid Interface Sci.
(2007)
J. Wang et al.
Biosens. Bioelectron.
(2013)

Y. Wang et al.

Biosens. Bioelectron.

(2012)

Y.M. Wu et al.

Biosens. Bioelectron.

(2013)

H.R. Zhang et al.

Electrochem. Commun.

(2012)

E. Babu et al.

J. Fluoresc.

(2013)

Y. Bae et al.

Nano Lett.

(2004)

V. Biju et al.

Anal. Bioanal. Chem.

(2008)

K. Boeneman et al.

J. Am. Chem. Soc.

(2009)

S. Centi et al.

Anal. Chem.

(2007)

L. Deng et al.

Nanoscale

(2012)

S.R. Forrest

Chem. Rev.

(1997)

L.J. He et al.

Chem. Commun.

(2013)

Cited by (40)

A dual-stimuli responsive electrochemiluminescence biosensor for pathogenic bacterial sensing and killing in foods
2023, Talanta
Pathogenic bacterial contamination of food-associated products threatens food safety. Herein, a dual-stimuli responsive electrochemiluminescence (ECL) sensor was constructed for the determination and sterilization of Staphylococcus aureus (S. aureus). Silver nanoclusters labeled hairpin DNA (H–Ag NCs) acted as the energy acceptor of ECL emission from CdS quantum dots (CdS QDs), generating resonance energy transfer (RET) and quenching ECL signal. After activation of DNA walker by S. aureus and cleavage of nicking endonuclease, Ag NCs were liberated from CdS QDs surface, and then gold nanoparticles (Au NPs) were introduced. ECL signal was enhanced by the energy transfer from ECL-excited surface plasmon resonance (SPR) in Au NPs to CdS QDs. Consequently, the proposed method performed well in S. aureus test with a linear range of 5–10⁸ CFU/mL. This sensing system achieved the high discrimination and killing of S. aureus in foods, illuminating the reliability in practical applications.
Gold nanoparticle-based signal amplified electrochemiluminescence for biosensing applications
2022, Talanta
Since the content levels of biomarkers at the early stage of many diseases are generally lower than the detection threshold concentration, achieving ultrasensitive and accurate detection of these biomarkers is still one of the major goals in bio-analysis. To achieve ultrasensitive and reliable bioassay, it requires developing highly sensitive biosensors. Among all kinds of biosensors, electrogenerated chemiluminescence (ECL) based biosensors have attracted enormous attention due to their excellent properties. In order to improve the performance of ECL biosensors, gold nanoparticles (Au NPs) have been widely utilized as signal amplification tags. The introduction of Au NPs could dramatically enhance the performance of the constructed ECL biosensors via diverse ways such as electrode modification material, efficient energy acceptor in ECL resonant energy transfer (ECL-RET), reaction catalyst, surface plasmon resonance (SPR) enhancer, and as nanocarrier. Herein, we summarize recent developments and progress of ECL biosensors based on Au NPs signal amplification strategies. We will cover ECL applications of Au NPs as a signal amplification tag in the detection of proteins, metal ions, nucleic acids, small molecules, living cells, exosomes, and cell imaging. Finally, brief summary and future outlooks of this field will be presented.
A dual-signal electrochemiluminescence immunosensor based on Ru(bpy)<inf>3</inf><sup>2+</sup>@3D-foam graphene and SnS<inf>2</inf> dots for sensitive detection of gastric cancer biomarker CA 72-4
2021, Talanta
A novel dual-signal electrochemiluminescence immunosensor with high sensitivity was successfully constructed for the sensitive detection of gastric cancer biomarker CA 72–4. The superior performance of the electrochemiluminescence immunosensor came from the self-calibration function of the dual-signal system “Ru(bpy)₃²⁺@3D-foam graphene/TPA” and “SnS₂ dots/K₂S₂O₈”. 3D-foam graphene not only has good electrical conductivity and ideal surface area, but also contains amino groups on its surface, which facilitate electron transfer and can carry a large number of luminous reagents. Furthermore, immobilized Ru(bpy)₃Cl₂·6H₂O on 3D-foam graphene to construct an ECL immunosensor, which can reduce the distance between the illuminant and the surface of electrode, thus highly increasing the ECL intensity. Additionally, the SnS₂ dot with excellent stability and outstanding biocompatibility is an ideal candidate for efficient cross-linking to the anti-CA 72–4. The dual-signal immunosensor is prepared by linking SnS₂ dots-Ab₂ and CA 72–4 through specific recognition. Generally, the ECL intensity of electrochemiluminescence immunosensor changes linearly with the logarithm of CA 72–4 concentration in the range from 5 × 10⁻⁵ to 5 × 10² U mL⁻¹ and the detection limit of 1.48 × 10⁻⁵ U mL⁻¹ (S/N = 3). Furthermore, the experiment results show that the constructed CA 72–4 immunosensor has excellent reproducibility and can be used for the sensitive detection of CA 72–4 in human serum. The approach opens up the new way for clinical bioassays.
Recent advances in electrochemiluminescence resonance energy transfer for bioanalysis: Fundamentals and applications
2020, TrAC - Trends in Analytical Chemistry
Citation Excerpt :
Recently, enormous efforts have been devoted to the LSPR-coupled ERET biosensors and huge developments have been achieved. In the past few years, Au nanoparticles have attracted substantial interests for bioanalysis [80]. Due to strong plasmon absorption induced by the SPR, the Au nanoparticles could be used as the energy acceptors in ERET [81].
Electrochemiluminescence resonance energy transfer (ERET) is a powerful analytical strategy based on the resonance energy transfer (RET) between an efficient electrochemiluminescence (ECL) emitter and a spectrally matched energy acceptor. Compared with fluorescence resonance energy transfer (FRET), ERET is more intriguing because it can eliminate the interference from unselective photoexcitation and the scattered light. In recent years, ERET has drawn wide concern for the analysis of the trace amounts of different targets due to its remarkable advantages of high sensitivity, inexpensive instruments and excellent controllability. This review detailly discuss the main mechanisms for the ERET process between the donor-acceptor pairs. We also comment on the latest progress of signaling strategies in the ERET process and their applications for the bioanalysis of small molecules, proteins and nucleic acids. Finally, perspectives and challenges in this field are also discussed.
Multi-functional electrochemiluminescence aptasensor based on resonance energy transfer between Au nanoparticles and lanthanum ion-doped cadmium sulfide quantum dots
2019, Analytica Chimica Acta
Novel lanthanum ion-doped cadmium sulfide quantum dots (CdS:La QDs) were synthesized and characterized by transmission electron microscopy (TEM) and photoluminescence (PL). Based on CdS:La QDs as the electrochemiluminescence (ECL) luminophores, a distance-dependent ECL intensity enhanced or quenched system between CdS:La QDs and gold nanoparticles (Au NPs) was designed. Firstly, ssDNA 1 was linked to the CdS:La QDs modified glassy carbon electrode via amide bond. Then the prepared Au NP–ssDNA 2 conjugates were used to hybridize with ssDNA 1, the surface plasmon resonances (SPR) of Au NPs enhanced ECL intensity (signal on) while Au NPs and CdS:La QDs were separated at a certain distance. Secondly, In the presence of Hg²⁺, the oligonucleotide conformation changed from linear chain to hairpin due to the thymine–Hg²⁺–thymine (T–Hg²⁺–T) base pairs. ECL quenching (signal off) achieved lie in resonance energy transfer (RET) between the CdS:La QDs and the proximal Au NPs at a close distance. Finally, after being incubated with TB, a strong and stable TB–aptamer complex was generated, which led to the release of Au NP–ssDNA 2 conjugates. The ECL signal of the CdS:La QDs was ultimately recovered (signal on again). The “on–off–on” approach was used to detect Hg²⁺ and TB, sensitively and respectively. The line ranges were 1.00 × 10⁻¹² –1.00 × 10⁻⁵ mol L⁻¹ and 1.00 × 10⁻¹⁶ –1.00 × 10⁻⁶ mol L⁻¹, respectively. The low limits of detection (S/N = 3) were at 3.00 × 10⁻¹³ mol L⁻¹ and 3.00 × 10⁻¹⁷ mol L⁻¹. Moreover, the ECL sensor exhibited high selectivity and good stability, and was successfully applied to the detection of TB in real sample.
Aptamer-peptide conjugates as a new strategy to modulate human α-thrombin binding affinity
2019, Biochimica et Biophysica Acta - General Subjects
Citation Excerpt :
Recently, modified TBA derivatives with higher antiproliferative activity and lower anticoagulant properties have been described [30,31]. In addition, TBA has been used for the construction of biosensors for the detection of thrombin [32] and it has been used as model compound for the optimization of aptasensors [33]. New approaches for the design of pharmaceutical agents against thrombin could possibly take into account the synergistic effect of polyvalent binder's.
Aptamers are single-stranded RNA or DNA molecules that specifically recognize their targets and have proven valuable for functionalizing sensitive biosensors. α-thrombin is a trypsin-like serine proteinase which plays a crucial role in haemostasis and thrombosis. An abnormal activity or overexpression of this protein is associated with a variety of diseases. A great deal of attention was devoted to the construction of high-throughput biosensors for accurately detect thrombin for the early diagnosis and treatment of related diseases. Herein, we propose a new approach to modulate the interaction between α-thrombin and the aptamer TBA₁₅. To this end, TBA₁₅ was chemically conjugated to two peptide sequences (TBA-G₃FIE-Ac and TBA-G₃EIF-Ac) corresponding to a short fragment of the acidic region of the human factor V, which is known to interact directly with exosite I. Surface Plasmon Resonance (SPR) results showed enhanced analytical performances of thrombin with TBA-G₃EIF-Ac than with TBA wild-type, reaching a limit of detection as low as 44.9 pM. Electrophoresis mobility shift assay (EMSA) corroborated the SPR results. Molecular dynamics (MD) simulations support experimental evidences and provided further insight into thrombin/TBA-peptide interaction. Our findings demonstrate that the combination of TBA₁₅ with key interacting peptides offers good opportunities to produce sensitive devices for thrombin detection and potential candidates to block thrombin activity.

View all citing articles on Scopus

View full text

An off–on–off electrochemiluminescence approach for ultrasensitive detection of thrombin

Highlights

Abstract

Introduction

Section snippets

Reagents

Mechanism of the “off–on–off” ECL aptasensor

Conclusions

Acknowledgments

Neuron

Anal. Chim. Acta

Electrochim. Acta

Electrochim. Acta

Sens. Actuators B-Chem.

Anal. BioChem.

Biosens. Bioelectron.

Electrochem. Commun.

J. Colloid Interface Sci.

Biosens. Bioelectron.

Biosens. Bioelectron.

Biosens. Bioelectron.

Electrochem. Commun.

J. Fluoresc.

Nano Lett.

Anal. Bioanal. Chem.

J. Am. Chem. Soc.

Anal. Chem.

Nanoscale

Chem. Rev.

Chem. Commun.