Characterization of quercetin binding site on DNA gyrase
Section snippets
Materials and methods
Preparation and isolation of recombinant gyrase A, B, and 24 kDa fragment of gyrase B. Coding region for the 24 kDa fragment of gyrase B was amplified by PCR from the isolated bacterial DNA. Sequences of primers for gyrA, gyrB, and 24 kDa N-terminal fragment of gyrB were: ATCGCATATGTCGAATTCTTATGACTC and ATCGGGATCCTAGCCTTCATAGTGGAAGTGGT. PCR product was cleaved with NcoI and BamHI and subcloned into the pET3a expression vector (Novagen). Production of recombinant proteins was carried out in
Inhibition of gyrase by quercetin
DNA supercoiling and relaxation experiments by gyrase were performed as a function of quercetin concentration. We have determined that quercetin inhibits formation of DNA supercoiling by gyrase from E. coli (Fig. 1B). In a separate experiment supercoiled DNA was used as a substrate for gyrase relaxation assay. Addition of quercetin promoted cleavage of DNA in the presence of gyrase at quercetin concentration above 80 μM (Fig. 1A) and maximal fraction of cleaved DNA is achieved at 640 μM. As a
Discussion
Inhibitory activity of flavonoids on class II topoisomerases has been demonstrated previously [21], [22]. It had been realized that the mechanism of inhibition is complex, however, it was generally assumed that the main binding target of flavonoids in topoisomerase II catalyzed reaction is DNA. Binding of flavonoids leads to the stabilization of the DNA–topo II complex causing cleavage of DNA [23]. Interaction of quercetin with single and double-stranded DNA has been shown by spectroscopic
Acknowledgements
This work was supported by the Ministry of Education, Science and Sport of the Republic of Slovenia and by KRKA d.d. pharmaceutical company. We thank Stanislav Zalar for his encouragement and support of the project and to Robert Bremšak for his excellent technical help.
References (33)
- et al.
The heat shock protein 90 antagonist novobiocin interacts with a previously unrecognized ATP-binding domain in the carboxyl terminus of the chaperone
J. Biol. Chem.
(2000) - et al.
Effects of flavonoids and vitamin C on oxidative DNA damage to human lymphocytes
Am. J. Clin. Nutr.
(1998) - et al.
Antimicrobial activities of some flavonoid compounds
Zentralbl. Mikrobiol.
(1986) - et al.
Antimicrobial effects of Finnish plant extracts containing flavonoids and other phenolic compounds
Int. J. Food Microbiol.
(2000) - et al.
Mechanism of topoisomerase II inhibition by staurosporine and other protein kinase inhibitors
J. Biol. Chem.
(1996) - et al.
Slow interaction of 5′-adenylyl-β,γ-imidodiphosphate with Escherichia coli DNA gyrase. Evidence for cooperativity in nucleotide binding
J. Biol. Chem.
(1992) Quercetin and DNA in solution: analysis of the dynamics of their interaction with a linear dichroism study
Int. J. Biol. Macromol.
(1996)The flavonols quercetin, rutin and morin in DNA solution: UV–vis dichroic (and mid-infrared) analysis explain the possible association between the biopolymer and a nucleophilic vegetable-dye
Biochim. Biophys. Acta
(1997)- et al.
Plasma concentrations of phyto-oestrogens in Japanese men
Lancet
(1993) - et al.
The F1 ATP synthetase β-subunit: a major yeast novobiocin binding protein
J. Cell Sci.
(1990)
Novobiocin inhibits passive chromatin assembly in vitro
EMBO J.
Occurrence of flavonoid aglycones in medicinal plants
Prog. Clin. Biol. Res.
Inhibitors of cyclin-dependent kinases as anti-cancer therapeutics [In Process Citation]
Curr. Med. Chem.
Inhibitory effects of the tyrosine kinase inhibitor genistein on mammalian DNA topoisomerase II
Cancer Res.
A comparison of active site binding of 4-quinolones and novel flavone gyrase inhibitors to DNA gyrase
Adv. Exp. Med. Biol.
Glycosylated flavones as selective inhibitors of topoisomerase IV
Antimicrob. Agents Chemother.
Cited by (291)
Anti-bacterial, anti-biofilm and anti-quorum sensing activities of honey: A review
2023, Journal of EthnopharmacologyCampomanesia xanthocarpa (Mart.) O. Berg: Therapeutic potential through a comprehensive review of biological activities and phenolic compound interactions
2023, Biocatalysis and Agricultural BiotechnologySynthesis, spectral, antibacterial and QSAR studies of tin and silicon complexes with Schiff base of amino acids
2023, Journal of Molecular StructureA critical review on quercetin bioflavonoid and its derivatives: Scope, synthesis, and biological applications with future prospects
2023, Arabian Journal of ChemistryRegiospecific 3′-C-prenylation of naringenin by Nocardiopsis gilva prenyltransferase
2023, Enzyme and Microbial Technology